Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UBE2DNL-ubiquitin-conjugating enzyme E2D N-terminal like pseudogene Gene
PTXBC040290
New product
Data sheet of UBE2DNL-ubiquitin-conjugating enzyme E2D N-terminal like pseudogene Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE2DNL-ubiquitin-conjugating enzyme E2D N-terminal like pseudogene Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC040290 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE2DNL |
| Origin species: | Human |
| Product name: | UBE2DNL-ubiquitin-conjugating enzyme E2D N-terminal like pseudogene Gene |
| Size: | 2ug |
| Accessions: | BC040290 |
| Gene id: | 100131816 |
| Gene description: | ubiquitin-conjugating enzyme E2D N-terminal like pseudogene |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccctaaagctcatccacaaggagttcctcgaactggcccgcgacccccagccccactgctcagcagggccagtgtgggacgatatgctccactggcaggccaccataacgaggcccaacgacagctcctacctgggaggggtcttcttcctaaagtttccctccgactacctattcaaaccacccaagatcaaatttaccaacggaatttaccatcaacgttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 27 (fatty acid transporter), member 4 - transition protein 1 (during histone to protamine replacement) - glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) - potassium voltage-gated channel, KQT-like subfamily, member 5 |