Cart 5 Product Products 803,26 € (empty)
-
1 x RGS1...259,07 € -
1 x FAM163A-fa...113,40 € -
1 x TMPO-thymo...121,50 € -
1 x RASSF8-Ras...121,50 € -
No products
To be determined Shipping
803,26 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 803,26 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 803,26 €
View larger 
Data sheet of SOX15-SRY (sex determining region Y)-box 15 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SOX15-SRY (sex determining region Y)-box 15 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000985 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SOX15 |
| Origin species: | Human |
| Product name: | SOX15-SRY (sex determining region Y)-box 15 Gene |
| Size: | 2ug |
| Accessions: | BC000985 |
| Gene id: | 6665 |
| Gene description: | SRY (sex determining region Y)-box 15 |
| Synonyms: | SOX20; SOX26; SOX27; protein SOX-15; SRY (sex determining region Y)-box 15; SRY (sex determining region Y)-box 20; SRY-box 15 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgctaccaggctcctcacaggaccaggcctggagcctggagcctccggctgccacggctgctgcctcctcatcttcgggaccccaggagcgggagggcgctgggagccccgcggcccccgggacgctgcccctggagaaggtgaagcggccgatgaacgcgttcatggtgtggagctccgctcagcgccgccagatggcgcagcagaaccccaagatgcacaactccgagatctccaagcgcctgggcgcgcagtggaagctgctggacgaggacgagaagcggcccttcgtggaggaggccaagcggctccgcgcccgacacctgcgcgactaccccgactacaagtaccggcctcggcgcaaggccaagagctcgggcgccggaccttcccgctgcggacagggaagaggcaacctggccagcggcggcccgctctgggggccggggtacgcgaccacccaaccgagcagaggctttgggtacagaccccccagctactcgacagcctacctgcctggcagctatggctcttcccactgcaaactggaagccccctcaccgtgctccctccctcagagtgaccctaggctccagggggaactgctgcccacctatacccactacctgccccctggctctcccactccatacaaccctccccttgctggtgcccccatgcccctaacccacctctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NLR family, pyrin domain containing 1 - single-stranded DNA binding protein 1 - phenylethanolamine N-methyltransferase - hydroxyacylglutathione hydrolase-like |