Cart 4 Product Products 454,57 € (empty)
-
1 x HCFC1R1-ho...113,40 € -
1 x DDX19B-DEA...121,50 € -
1 x IFNG-inter...113,40 € -
No products
To be determined Shipping
454,57 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 454,57 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 454,57 €
Data sheet of EMP3-epithelial membrane protein 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EMP3-epithelial membrane protein 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009718 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EMP3 |
| Origin species: | Human |
| Product name: | EMP3-epithelial membrane protein 3 Gene |
| Size: | 2ug |
| Accessions: | BC009718 |
| Gene id: | 2014 |
| Gene description: | epithelial membrane protein 3 |
| Synonyms: | YMP; epithelial membrane protein 3; EMP-3; HNMP-1; hematopoietic neural membrane protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcactcctcttgctggtggtctcagcccttcacatcctcattcttatactgcttttcgtggccactttggacaagtcctggtggactctccctgggaaagagtccctgaatctctggtacgactgcacgtggaacaacgacaccaaaacatgggcctgcagtaatgtcagcgagaatggctggctgaaggcggtgcaggtcctcatggtgctctccctcattctctgctgtctctccttcatcctgttcatgttccagctctacaccatgcgacgaggaggtctcttctatgccaccggcctctgccagctttgcaccagcgtggcggtgtttactggcgccttgatctatgccatccacgccgaggagatcctggagaagcacccgcgagggggcagcttcggatactgcttcgccctggcctgggtggccttccccctcgccctggtcagcggcatcatctacatccacctacggaagcgggagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein, large, P2 - four and a half LIM domains 2 - polycomb group ring finger 6 - mab-21-like 2 (C. elegans) |