Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
VAT1-vesicle amine transport protein 1 homolog (T. californica) Gene
PTXBC008725
New product
Data sheet of VAT1-vesicle amine transport protein 1 homolog (T. californica) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VAT1-vesicle amine transport protein 1 homolog (T. californica) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008725 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VAT1 |
| Origin species: | Human |
| Product name: | VAT1-vesicle amine transport protein 1 homolog (T. californica) Gene |
| Size: | 2ug |
| Accessions: | BC008725 |
| Gene id: | 10493 |
| Gene description: | vesicle amine transport protein 1 homolog (T. californica) |
| Synonyms: | VATI; synaptic vesicle membrane protein VAT-1 homolog; membrane protein of cholinergic synaptic vesicles; vesicle amine transport protein 1 homolog (T. californica); vesicle amine transport 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccgacgagagagaggtagccgaggcagcgaccggggaagacgcctcttcgccgcctccgaaaaccgaggcagcgagcgacccccagcatcccgcggcctccgaaggggccgccgccgccgccgcctcgccgccactgctgcgctgcctagtgctcaccggctttggaggctacgacaaggtgaagctgcagagccggccggcagcgcccccggcccctgggcccggccagctgacgctgcgtctgcgggcctgcgggctcaacttcgcagacctcatggctaggcaggggctgtacgaccgtctcccgcctctgcctgtcactccgggcatggagggcgcgggtgttgtgatcgcagtgggcgagggagtcagcgaccgcaaggcaggagaccgggtgatggtgttgaaccggtcagggatgtggcaggaagaggtgactgtgccctcggtccagaccttcctgattcctgaggccatgacctttgaggaagctgctgccttgctcgtcaattacattacagcctacatggtcctctttgacttcggcaacctacagcctggccacagcgtcttggtacacatggctgcagggggtgtgggtatggctgccgtgcagctgtgccgtacagtggagaatgtgacagtgttcggaacggcctcggccagcaagcacgaggcactgaaggagaatggggtcacacatcccatcgactatcacacgactgactacgtggatgagatcaagaagatttcccctaaaggagtggacattgtcatggaccctctgggtgggtcagatactgccaagggctacaacctcctgaaacccatgggcaaagtcgtcacctatggaatggccaacctgctgacgggccccaaacggaacctgatggccctggcccggacatggtggaatcagttcagcgtgacagctctgcagctgctgcaggccaaccgggctgtgtgtggcttccacctgggctacctggatggtgaggtggagctggtcagtggtgtggtggcccgcctcctggctctgtacaaccagggccacatcaagccccacattgactcagtctggcccttcgagaaggtggctgatgccatgaaacagatgcaggagaagaagaatgtgggcaaggtcctcctggttccagggccagagaaggagaactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa - mago-nashi homolog, proliferation-associated (Drosophila) - N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 - protein kinase (cAMP-dependent, catalytic) inhibitor gamma |