MT1X-metallothionein 1X Gene View larger

MT1X-metallothionein 1X Gene

PTXBC018190

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MT1X-metallothionein 1X Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MT1X-metallothionein 1X Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018190
Product type: DNA & cDNA
Ncbi symbol: MT1X
Origin species: Human
Product name: MT1X-metallothionein 1X Gene
Size: 2ug
Accessions: BC018190
Gene id: 4501
Gene description: metallothionein 1X
Synonyms: MT-1l; MT1; metallothionein-1X; MT-1X; MT-IX; metallothionein-IX; testicular tissue protein Li 124; metallothionein 1X
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaccccaactgctcctgctcgcctgttggctcctgtgcctgtgccggctcctgcaaatgcaacgagtgcaaatgcacctcctgcaagaagagctgctgctcctgctgccctgtgggctgtgccaagtgtgcccagggctgcatctgcaaagggacgtcagacaagtgcagctgctgtgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - F-box protein 27
- NODAL modulator 3
- F-box protein 44
- pyruvate carboxylase

Reviews

Buy MT1X-metallothionein 1X Gene now

Add to cart