Cart 7 Product Products 782,74 € (empty)
-
1 x C7orf61-ch...113,40 € -
1 x EEF1B2-euk...113,40 € -
1 x MS4A3-memb...113,40 € -
1 x CLTB-clath...113,40 € -
-
-
1 x FAM136A-fa...113,40 €
No products
To be determined Shipping
782,74 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 782,74 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 782,74 €
Data sheet of PRRT1-proline-rich transmembrane protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRRT1-proline-rich transmembrane protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013201 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRRT1 |
| Origin species: | Human |
| Product name: | PRRT1-proline-rich transmembrane protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC013201 |
| Gene id: | 80863 |
| Gene description: | proline-rich transmembrane protein 1 |
| Synonyms: | C6orf31; DSPD1; IFITMD7; NG5; proline-rich transmembrane protein 1; dispanin subfamily D member 1; interferon induced transmembrane protein domain containing 7; proline rich transmembrane protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgggcacccagactccagcaccggccgaggacccccactccggctgcagggaccctgtcccagcgagaccgcaggcatgtcatccgaaaagtcaggagactcgcttcgagggcccacttcccccgccgccgcccgctgccgccgccccgcccccgccggcgccagcccagactgcccaggcccctggcttcgtggtgcccacgcacgcggggactgtgggcacgctgccgctggggggctacgtagcgcccggataccccctgcagctgcagccttgcactgcttacgtgccggtctacccggtgggcacgccatatgcaggcgggaccccggggggaacaggagtgacctccactctccccccgccgccccagggcccagggctggccctactggagccgaggcgcccgccacacgactacatgcccatcgcggtgctgaccaccatctgttgcttctggcctactggcatcattgccatcttcaaggccgtgcaggtgcgcacggccttggcccgcggagacatggtgtcggccgagatcgcttcacgcgaggcccggaacttctccttcatctccctggccgtgggcatcgcggccatggtgctctgtaccatcctcaccgtagtcatcatcatcgccgcgcagcaccacgagaactactgggatccctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger, DHHC-type containing 7 - chromosome 4 open reading frame 14 - chromosome 3 open reading frame 20 - RAP2C, member of RAS oncogene family |