Cart 2 Product Products 234,90 € (empty)
-
1 x KCTD14-pot...113,40 € -
1 x CGRRF1-cel...121,50 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
Data sheet of GZMM-granzyme M (lymphocyte met-ase 1) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GZMM-granzyme M (lymphocyte met-ase 1) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025701 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GZMM |
| Origin species: | Human |
| Product name: | GZMM-granzyme M (lymphocyte met-ase 1) Gene |
| Size: | 2ug |
| Accessions: | BC025701 |
| Gene id: | 3004 |
| Gene description: | granzyme M (lymphocyte met-ase 1) |
| Synonyms: | LMET1; MET1; granzyme M; HU-Met-1; Met-1 serine protease; lymphocyte met-ase 1; met-ase; natural killer cell granular protease |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggcctgcgtgtcttcactgctggtgctggccctgggggccctgtcagtaggcagctcctttgggacccagatcatcgggggccgggaggtgatcccccactcgcgcccgtacatggcctcactgcagagaaatggctcccacctgtgcgggggtgtcctggtgcacccaaagtgggtgctgacggctgcccactgcctggcccagcggatggcccagctgaggctggtgctggggctccacaccctggacagccccggtctcaccttccacatcaaggcagccatccagcaccctcgctacaagcccgtccctgccctggagaacgacctcgcgctgcttcagctggacgggaaagtgaagcccagccggaccatccggccgttggccctgcccagtaagcgccaggtggtggcagcagggactcggtgcagcatggccggctgggggctgacccaccagggcgggcgcctgtcccgggtgctgcgggagctggacctccaagtgctggacacccgcatgtgtaacaacagccgcttctggaacggcagcctctcccccagcatggtctgcctggcggccgactccaaggaccaggctccctgcaagggtgactcgggcgggcccctggtgtgtggcaaaggccgggtgttggccggagtcctgtccttcagctccagggtctgcactgacatcttcaagcctcccgtggccaccgctgtggcgccttacgtgtcctggatcaggaaggtcaccggccgatcggcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - growth arrest-specific 2 like 1 - A kinase (PRKA) anchor protein 7 - ras homolog gene family, member D - hypothetical protein MGC34800 |