TMEM39A-transmembrane protein 39A Gene

View larger

TMEM39A-transmembrane protein 39A Gene

Reference: PTXBC003192

Condition: New product

Print

Data sheet of TMEM39A-transmembrane protein 39A Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about TMEM39A-transmembrane protein 39A Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC003192
Product type:	DNA & cDNA
Ncbi symbol:	TMEM39A
Origin species:	Human
Product name:	TMEM39A-transmembrane protein 39A Gene
Size:	2ug
Accessions:	BC003192
Gene id:	55254
Gene description:	transmembrane protein 39A
Synonyms:	transmembrane protein 39A
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgcccggtggaaggaggggccctagtcggcaacagctaagccgttcagctttaccttctttgcagactttggttggtggaggctgtggcaatggaacaggcttgagaaacaggaatggtagtgctattggccttccagtcccacctatcacagccttaatcaccccaggtcctgttcgtcattgccaaattcctgacttgcctgtggatgggagcctactctttgaattcctttttttcatctacctgttggttgctcttttcattcagtacatcaacatttataaaacagtgtggtggtatccttacaatcatcctgcttcttgtacatcactgaattttcatctcattgattatcatctggcagcattcatcacagtgatgcttgcgaggaggcttgtatgggctctcatctcagaggtctgtgtgtgtaagctctga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- kelch-like 36 (Drosophila) - transmembrane protein 196 - ancient ubiquitous protein 1 - tet oncogene family member 3

Reviews

Be the first to write your review !

Buy TMEM39A-transmembrane protein 39A Gene now