HIST1H3F-histone cluster 1, H3f Gene View larger

HIST1H3F-histone cluster 1, H3f Gene

PTXBC067492

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HIST1H3F-histone cluster 1, H3f Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HIST1H3F-histone cluster 1, H3f Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC067492
Product type: DNA & cDNA
Ncbi symbol: HIST1H3F
Origin species: Human
Product name: HIST1H3F-histone cluster 1, H3f Gene
Size: 2ug
Accessions: BC067492
Gene id: 8968
Gene description: histone cluster 1, H3f
Synonyms: H3/i; H3FI; histone H3.1; H3 histone family, member I; histone 1, H3f; histone H3/i; histone cluster 1, H3f; histone cluster 1 H3 family member f
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcgcactaagcaaacagctcgtaagtccactggcggcaaagccccgcgcaagcagctggccactaaggcggcccgcaaaagcgcgccagccaccggtggcgtgaagaagccccaccgctacaggcctggtactgtcgccctccgtgaaatccgccgctatcagaaatcgactgagctactgattcgcaagctaccattccagcgtctggtacgtgagatcgcgcaggacttcaagaccgacctgcgcttccagagctcggctgtgatggcgctgcaggaggcctgcgaggcttacctggtggggctctttgaggacaccaacctgtgtgctatccacgccaagcgagtgactatcatgcccaaggacatccagctcgctcgccgcattcgcggagagagggcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - calpain, small subunit 2
- 2-hydroxyacyl-CoA lyase 1
- E2F transcription factor 3
- SH2 domain containing 3C

Reviews

Buy HIST1H3F-histone cluster 1, H3f Gene now

Add to cart