No products
Prices are tax excluded
PTXBC002563
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC002563 |
Product type: | DNA & cDNA |
Ncbi symbol: | SLC39A1 |
Origin species: | Human |
Product name: | SLC39A1-solute carrier family 39 (zinc transporter), member 1 Gene |
Size: | 2ug |
Accessions: | BC002563 |
Gene id: | 27173 |
Gene description: | solute carrier family 39 (zinc transporter), member 1 |
Synonyms: | ZIP1; ZIRTL; zinc transporter ZIP1; solute carrier family 39 (zinc transporter), member 1; solute carrier family 39 (zinc transporter), member 3; zrt- and Irt-like protein 1; solute carrier family 39 member 1 |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atggggccctggggagagccagagctcctggtgtggcgccccgaggcggtagcttcagagcctccagtgcctgtggggctggaggtgaagttgggggccctggtgctgctgctggtgctcaccctcctctgcagcctggtgcccatctgtgtgctgcgccggccaggagctaaccatgaaggctcagcttcccgccagaaagccctgagcctagtaagctgtttcgcggggggcgtctttttggccacttgtctcctggacctgctgcctgactacctggctgccatagatgaggccctggcagccttgcacgtgacgctccagttcccactgcaagagttcatcctggccatgggcttcttcctggtcctggtgatggagcagatcacactggcttacaaggagcagtcagggccgtcacctctggaggaaacaagggctctgctgggaacagtgaatggtgggccgcagcattggcatgatgggccaggggtcccacaggcgagtggagccccagcaaccccctcagccttgcgtgcctgtgtactggtgttctccctggccctccactccgtgttcgaggggctggcggtagggctgcagcgagaccgggctcgggccatggagctgtgcctggctttgctgctccacaagggcatcctggctgtcagcctgtccctgcggctgttgcagagccaccttagggcacaggtggtggctggctgtgggatcctcttctcatgcatgacacctctaggcatcgggctgggtgcagctctggcagagtcggcaggacctctgcaccagctggcccagtctgtgctagagggcatggcagctggcacctttctctatatcacctttctggaaatcctgccccaggagctggccagttctgagcaaaggatcctcaaggtcattctgctcctagcaggctttgccctgctcactggcctgctcttcatccaaatctag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - solute carrier family 39 (zinc transporter), member 3 - dehydrogenase E1 and transketolase domain containing 1 - general transcription factor IIF, polypeptide 1, 74kDa - potassium channel tetramerisation domain containing 15 |