Cart 2 Product Products 234,90 € (empty)
-
1 x KCTD14-pot...113,40 € -
1 x CGRRF1-cel...121,50 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
Data sheet of GNRH2-gonadotropin-releasing hormone 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNRH2-gonadotropin-releasing hormone 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069362 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNRH2 |
| Origin species: | Human |
| Product name: | GNRH2-gonadotropin-releasing hormone 2 Gene |
| Size: | 2ug |
| Accessions: | BC069362 |
| Gene id: | 2797 |
| Gene description: | gonadotropin-releasing hormone 2 |
| Synonyms: | GnRH-II; LH-RHII; progonadoliberin-2; GnRH-associated peptide 2; GnRH-associated peptide II; Gonadoliberin II; Gonadoliberin-2; luliberin II; luteinizing hormone-releasing hormone II; progonadoliberin II; gonadotropin releasing hormone 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccagctccaggcgaggcctcctgctcctgctgctgctgactgcccaccttggaccctcagaggctcagcactggtcccatggctggtaccctggaggaaagcgagccctcagctcagcccaggatccccagaatgcccttaggcccccaggaagggccctggacactgcagcaggcagcccagtccagactgcccatggcctcccaagtgatgccctggctcccctggacgacagcatgccctgggagggcaggaccacggcccagtggtcccttcacaggaagcgacacctggcacggacactgctgaccgcagcccgagagccccgccccgccccgccatcctccaataaagtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin-conjugating enzyme E2S - lysophosphatidic acid receptor 1 - lysophosphatidic acid receptor 4 - hydrogen voltage-gated channel 1 |