Cart 4 Product Products 477,90 € (empty)
-
1 x ANKRD44-an...121,50 € -
1 x MOBP-myeli...113,40 € -
1 x CYTIP-cyto...121,50 € -
1 x C19orf47-c...121,50 €
No products
To be determined Shipping
477,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 477,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 477,90 €
Data sheet of MSI2-musashi homolog 2 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MSI2-musashi homolog 2 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017560 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MSI2 |
| Origin species: | Human |
| Product name: | MSI2-musashi homolog 2 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC017560 |
| Gene id: | 124540 |
| Gene description: | musashi homolog 2 (Drosophila) |
| Synonyms: | MSI2H; RNA-binding protein Musashi homolog 2; musashi homolog 2; musashi-2; musashi RNA binding protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtcacaagaacaaagaaaatatttgtaggcgggttatctgcgaacacagtagtggaagatgtaaagcaatatttcgagcagtttggcaaggtggaagatgcaatgctgatgtttgataaaactaccaacaggcacagagggtttggctttgtcacttttgagaatgaagatgttgtggagaaagtctgtgagattcatttccatgaaatcaataataaaatggtagaatgtaagaaagctcagccgaaagaagtcatgttcccacctgggacaagaggccgggcccggggactgccttacaccatggacgcgttcatgcttggcatggggatgctgggatatcccaacttcgtggcgacctatggccgtggctaccccggatttgctccaagctatggctatcagttcccagactatttgccggtttcacaagacataatttttatcaactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Notch homolog 4 (Drosophila) - inducible T-cell co-stimulator - transmembrane protein 126B - melanoma antigen family D, 1 |