LRRIQ3-leucine-rich repeats and IQ motif containing 3 Gene View larger

LRRIQ3-leucine-rich repeats and IQ motif containing 3 Gene

PTXBC020778

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LRRIQ3-leucine-rich repeats and IQ motif containing 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LRRIQ3-leucine-rich repeats and IQ motif containing 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020778
Product type: DNA & cDNA
Ncbi symbol: LRRIQ3
Origin species: Human
Product name: LRRIQ3-leucine-rich repeats and IQ motif containing 3 Gene
Size: 2ug
Accessions: BC020778
Gene id: 127255
Gene description: leucine-rich repeats and IQ motif containing 3
Synonyms: LRRC44; leucine-rich repeat and IQ domain-containing protein 3; leucine rich repeat containing 44; leucine-rich repeat-containing protein 44; leucine rich repeats and IQ motif containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttcatggaacagtcacagaagagctaaccagtcatgaagaatggagtcactataatgaaaacataagagaaggtcaaaaagattttgtttttgtgaagttcaatggccttcatttaaagtctatggaaaatttgcagtcttgcatctctcttagagtatgcatcttctcaaacaattttattacagatattcatccacttcaaagttgtataaaattaatcaaacttgatctccatggaaatcagataaagagtctaccaaataccaaattttggaatggattgaagaacctaaaactactctatcttcatgacaatgggtttgcaaagttaaagaatatatgtgtattatctgcctgtccaaccctcattgccctcactatgtttgattgtccagtaagccttaaaaaaggatatagacatgttcttgttaacagtatatggcctctcaaagcgctggatcatcatgtgatttctgatgaagaaataattcagaactggcatcttcctgaaagattcaaagcatgtaaccatcgacttttctttaatttctgcccagctttgagaaaggagaaaatgaagcatagtgaggtttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine rich repeat and Ig domain containing 1
- transportin 2 (importin 3, karyopherin beta 2b)
- tumor necrosis factor (TNF superfamily, member 2)
- BCL2/adenovirus E1B 19kDa interacting protein 1

Reviews

Buy LRRIQ3-leucine-rich repeats and IQ motif containing 3 Gene now

Add to cart