Cart 38 Product Products 5 017,50 € (empty)
-
-
1 x C6orf168-c...121,50 € -
1 x FAM122C-fa...113,40 € -
1 x MR1-major...121,50 € -
-
1 x FLJ34048-h...113,40 € -
1 x MPHOSPH6-M...113,40 € -
1 x SYP-synapt...121,50 € -
1 x FAM151B-fa...121,50 € -
-
1 x SLC48A1-so...113,40 € -
1 x MRPL44-mit...121,50 € -
1 x PSMB7-prot...121,50 € -
1 x LINCR-like...113,40 € -
-
-
1 x PTPN7-prot...121,50 € -
1 x NAPRT1-nic...121,50 € -
1 x C2orf56-ch...113,40 € -
1 x PPIL1-pept...113,40 € -
1 x DUSP13-dua...113,40 € -
1 x C17orf89-c...113,40 € -
1 x LRRN4CL-LR...113,40 € -
1 x INPP1-inos...121,50 € -
1 x NRBF2-nucl...121,50 € -
1 x KLRAQ1-KLR...121,50 € -
-
-
-
1 x HLA-DQB2-m...113,40 € -
1 x GPR119-G...121,50 € -
-
1 x MITD1-MIT,...113,40 € -
-
1 x ATP5H-ATP...113,40 € -
1 x C16orf70-c...121,50 € -
1 x COX6B2-cyt...113,40 € -
No products
To be determined Shipping
5 017,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 38 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 017,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 017,50 €
View larger 
B4GALT6-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 Gene
PTXBC069620
New product
Data sheet of B4GALT6-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about B4GALT6-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069620 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | B4GALT6 |
| Origin species: | Human |
| Product name: | B4GALT6-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 Gene |
| Size: | 2ug |
| Accessions: | BC069620 |
| Gene id: | 9331 |
| Gene description: | UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 |
| Synonyms: | B4Gal-T6; beta4Gal-T6; beta-1,4-galactosyltransferase 6; UDP-Gal:beta-GlcNAc beta-1,4-galactosyltransferase 6; UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6; UDP-Gal:glucosylceramide beta-1,4-galactosyltransferase; UDP-galactose:beta-N-acetylglucosamine beta-1,4-galactosyltransferase 6; beta-1,4-GalTase 6; beta4GalT-VI |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgtgctcaggcggatgatgcgggtttccaatcgctctctcctcgccttcatcttcttcttctccctctcttcgtcctgtctgtacttcatctatgtggccccaggcatcgccaacacatatctctttatggtacaagctcgaggtataatgttgagagaaaatgtgaaaacaataggtcatatgatcaggctgtacacaaataaaaacagtacgctcaacggtacagattatcccgaaggcaataattcaagtgattatcttgttcaaacaacaacgtatctcccggaaaacttcacatactcaccatacctcccctgtccagaaaagctgccttatatgcgaggattcctcaatgtcaatgtaagcgaagtcagttttgatgaaattcatcaactcttctccaaggatttagatattgagccagggggtcattggaggccaaaagactgtaaacccagatggaagactggcacacaaccttttaaccgtgcgatgcttttcaatgtgggcttcaaagaggccatgaaagacagtgtctgggactgtgtaatcttccacgatgtggatcatctacctgaaaatgaccggaactattacggatgtggagaaatgccacgtcattttgctgcaaagctggataaatacatgtatattcttccatataaagaattttttggtggtgtaagtgggctgacagtggaacaatttagaaagatcaatggttttcctaatgccttctggggatggggaggagaagatgatgacctttggaacagagttcactatgctggatataatgtaaccagaccagagggagacttaggaaaatacaagtcaattcctcatcaccatagaggtgaagtccagtttttaggacggtataaattactaaggtattccaaggagcgtcagtacatcgatggactgaacaatttaatatataggccaaaaatactggttgataggttgtatacaaacatatctgtaaacctcatgccagagttagctccaatcgaagactattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - asp (abnormal spindle) homolog, microcephaly associated (Drosophila) - solute carrier family 1 (neutral amino acid transporter), member 5 - ATP-binding cassette, sub-family A (ABC1), member 11 (pseudogene) - protein tyrosine phosphatase, receptor type, C-associated protein |