Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MGC72080-MGC72080 pseudogene Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MGC72080-MGC72080 pseudogene Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC062733 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MGC72080 |
| Origin species: | Human |
| Product name: | MGC72080-MGC72080 pseudogene Gene |
| Size: | 2ug |
| Accessions: | BC062733 |
| Gene id: | 389538 |
| Gene description: | MGC72080 pseudogene |
| Synonyms: | ASNSD; TS11; asparagine synthetase [glutamine-hydrolyzing]; TS11 cell cycle control protein; glutamine-dependent asparagine synthetase; asparagine synthetase (glutamine-hydrolyzing) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgcctggtcacggtgctggggaacctgctcatcatcctggccatcagccctgactcccacctccacacccccatgtacttcttcctctccaacctgtccttgcctgacatcggtttcacctccaccacggtccccaagatgattgtggacatccagtctcacagcagagtcatctcctatgcaggctgcctgactcagatgtctctctttgccatttttggaggcatggaagagagacatgctcctgagtgtgatggcctatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - early growth response 1 - zinc finger protein 24 - RAN binding protein 9 - ring finger protein 10 |