Cart 2 Product Products 1 138,00 € (empty)
-
1 x TNF-beta494,00 € -
1 x Trefoil...644,00 €
No products
To be determined Shipping
1 138,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 138,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 138,00 €
View larger 
SERPINA6-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6 Gene
PTXBC056259
New product
Data sheet of SERPINA6-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SERPINA6-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC056259 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERPINA6 |
| Origin species: | Human |
| Product name: | SERPINA6-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6 Gene |
| Size: | 2ug |
| Accessions: | BC056259 |
| Gene id: | 866 |
| Gene description: | serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6 |
| Synonyms: | CBG; corticosteroid-binding globulin; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6; serpin A6; serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6; transcortin; serpin family A member 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccactcctcctgtacacctgtcttctctggctgcccaccagcggcctctggaccgtccaggccatggatcctaacgctgcttatgtgaacatgagtaaccatcaccggggcctggcttcagccaacgttgactttgccttcagcctgtataagcacctagtggccttgagtcccaaaaagaacattttcatctcccctgtgagcatctccatggccttagctatgctgtccctgggcacctgtggccacacacgggcccagcttctccagggcctgggtttcaacctcactgagaggtctgagactgagatccaccagggtttccagcacctgcaccaactctttgcaaagtcagacaccagcttagaaatgaccatgggcaatgccttgtttcttgatggcagcctggagttgctggagtcattctcagcagacatcaagcactactatgagtcagaggtcttggctatgaatttccaggactgggcaacagccagcagacagatcaacagctatgtcaagaataagacacaggggaaaattgtcgacttgttttcagggctggatagcccagccatcctcgtcctggtcaactatatcttcttcaaaggcacatggacacagccctttgacctggcaagcaccagggaggagaacttctatgtggacgagacaactgtggtgaaggtgcccatgatgttgcagtcgagcaccatcagttaccttcatgacgcggagctcccctgccagctggtgcagatgaactacgtgggcaatgggactgtcttcttcatccttccggacaaggggaagatgaacacagtcatcgctgcactgagccgggacacgattaacaggtggtccgcaggcctgaccagcagccaggtggacctgtacattccaaaggtcaccatctctggagtctatgacctcggagatgtgctggaggaaatgggcattgcagacttgttcaccaaccaggcaaatttctcacgcatcacccaggacgcccagctgaagtcatcaaaggtggtccataaagctgtgctgcaactcaatgaggagggtgtggacacagctggctccactggggtcaccctaaacctgacgtccaagcctatcatcttgcgtttcaaccagcccttcatcatcatgatcttcgaccacttcacctggagcagccttttcctggcgagggttatgaacccagtgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) - guanine nucleotide binding protein (G protein), beta polypeptide 3 - guanine nucleotide binding protein (G protein), beta polypeptide 2 - ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) |