Cart 3 Product Products 787,55 € (empty)
-
1 x PYCR1-pyrr...113,40 € -
-
No products
To be determined Shipping
787,55 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 787,55 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 787,55 €
Data sheet of MRPL20-mitochondrial ribosomal protein L20 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPL20-mitochondrial ribosomal protein L20 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC059945 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPL20 |
| Origin species: | Human |
| Product name: | MRPL20-mitochondrial ribosomal protein L20 Gene |
| Size: | 2ug |
| Accessions: | BC059945 |
| Gene id: | 55052 |
| Gene description: | mitochondrial ribosomal protein L20 |
| Synonyms: | L20mt; MRP-L20; 39S ribosomal protein L20, mitochondrial; mitochondrial ribosomal protein L20 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtcttcctcaccgcgcagctctggctgcggaatcgcgtcaccgaccgctactttcggatccaggaggtgctgaagcacgccaggcactttcggggaaggaaaaatcgctgctacaggttggcggtcagaaccgtgattcgagcctttgtgaaatgcaccaaagcccgatacctgaagaaaaagaacatgaggaccctctggattaatcgaattacagctgctagccaggaacatggactgaagtatccagcgctcattgggaatttagttaagtgccaggtggagctcaacaggaaagtcctagcggatctggccatctacgagccaaagactttcaaatctttggctgccttggccagtaggaggcgacacgaaggatttgctgctgccttgggggatgggaaggaacctgaaggcattttttccagagtggtgcagtaccactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 1 open reading frame 87 - similar to RIKEN cDNA 2310039H08 - immunoglobulin superfamily, member 8 - secretoglobin, family 1D, member 1 |