Cart 22 Product Products 2 492,06 € (empty)
-
1 x PSMC2-prot...121,50 € -
1 x NUDT2-nudi...113,40 € -
1 x LMAN2L-lec...121,50 € -
1 x C7orf49-ch...113,40 € -
1 x GLO1-glyox...113,40 € -
1 x DUT-deoxyu...113,40 € -
1 x C1orf123-c...113,40 € -
1 x CD200R1-CD...121,50 € -
1 x IMP3-IMP3,...113,40 € -
1 x COG3-compo...121,50 € -
-
-
1 x LIN28-lin-...113,40 € -
1 x XIRP2-xin...113,40 € -
-
1 x C11orf59-c...113,40 € -
1 x SNRPB-smal...113,40 € -
1 x USP47-ubiq...113,40 € -
1 x IL20RB-int...121,50 € -
1 x SLAMF1-sig...121,50 € -
-
1 x TM6SF1-tra...113,40 €
No products
To be determined Shipping
2 492,06 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 22 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 492,06 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 492,06 €
Data sheet of MRPS17-mitochondrial ribosomal protein S17 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPS17-mitochondrial ribosomal protein S17 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC054031 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPS17 |
| Origin species: | Human |
| Product name: | MRPS17-mitochondrial ribosomal protein S17 Gene |
| Size: | 2ug |
| Accessions: | BC054031 |
| Gene id: | 51373 |
| Gene description: | mitochondrial ribosomal protein S17 |
| Synonyms: | HSPC011; MRP-S17; RPMS17; S17mt; 28S ribosomal protein S17, mitochondrial; mitochondrial ribosomal protein S17 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccgtagttcgctcatccgtccatgccagatggattgtggggaaggtgattgggacaaaaatgcaaaagactgctaaagtgagagtgaccaggcttgttctggatccctatttattaaagtattttaataagcggaaaacctactttgctcacgatgcccttcagcagtgcacagttggggatattgtgcttctcagagctttacctgttccacgagcaaagcatgtgaaacatgaactggctgagatcgttttcaaagttggaaaagtcatagatccagtgacaggaaagccctgtgctggaactacctacctggagagtccgttgagttcggaaaccacccagctaagcaaaaatctggaagaactcaatatctcttcagcacagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - WNK lysine deficient protein kinase 1 - chromosome 6 open reading frame 97 - mitochondrial ribosomal protein L20 - chromosome 1 open reading frame 87 |