Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TUG1-taurine upregulated 1 (non-protein coding) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TUG1-taurine upregulated 1 (non-protein coding) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC037986 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TUG1 |
| Origin species: | Human |
| Product name: | TUG1-taurine upregulated 1 (non-protein coding) Gene |
| Size: | 2ug |
| Accessions: | BC037986 |
| Gene id: | 55000 |
| Gene description: | taurine upregulated 1 (non-protein coding) |
| Synonyms: | CDCBM4; GCP-1; TUBG; TUBGCP1; tubulin gamma-1 chain; gamma-tubulin complex component 1; tubulin, gamma polypeptide; tubulin gamma 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggactccagatttccagattttcaagacctggacctggaacccgaaagagcttgtcacgatgcggcaggaacactggaggtagatttttttttatttttgaattttgggactgttgaccttgctgtgagaaaagagacaacgactgagcaagcactaccaccagcactgttactgggaattagaagacctgagtttctgtccagaccctcagtgcaaactgaggatgctccatccaaagtgaattatgtcctgtgcctcctgattgctgagtgttcacctggaccttctgactaccttccctgtgctattccatcagcctacagacctggtacctggatttttgcccgagatgattcctaccaccttactactgacgaagacacccattccagtggaccactgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DEAH (Asp-Glu-Ala-His) box polypeptide 29 - Fanconi anemia, complementation group D2 - nitric oxide synthase 3 (endothelial cell) - lysosomal protein transmembrane 4 alpha |