Cart 52 Product Products 8 926,33 € (empty)
-
1 x SERPINA4-s...121,50 € -
-
1 x BRUNOL5-br...121,50 € -
1 x SERPINA10-...121,50 € -
1 x PMEPA1-pro...113,40 € -
1 x Phospho-HS...259,07 € -
-
-
1 x RNF7-ring...113,40 € -
1 x HBA1-hemog...113,40 € -
1 x PSG1-pregn...121,50 € -
1 x SERP1-stre...113,40 € -
-
-
1 x SERPINA3-s...121,50 € -
1 x OR2C1-olfa...121,50 € -
1 x HHAT-hedge...121,50 € -
-
1 x GCLM-gluta...121,50 € -
-
-
-
-
-
1 x CCDC108-co...113,40 € -
1 x GORASP2-go...121,50 € -
1 x SERPINB12-...121,50 € -
-
-
1 x OGG1-8-oxo...121,50 € -
1 x SERPINI2-s...121,50 € -
1 x ANGPTL4-an...121,50 € -
1 x sVCAM-1494,00 € -
-
1 x HAT1-histo...113,40 € -
1 x KRT8-kerat...121,50 € -
1 x APOBEC3G-a...113,40 € -
-
-
-
1 x IFI44-inte...121,50 € -
1 x GGT1-gamma...113,40 € -
1 x HEATR5A-HE...113,40 € -
1 x Visfatin...694,00 € -
-
1 x IFI44L-int...121,50 € -
1 x SERPINA7-s...121,50 € -
1 x Beclin-1...259,07 € -
-
-
1 x SERINC1-se...121,50 € -
No products
To be determined Shipping
8 926,33 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 52 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 8 926,33 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 8 926,33 €
Data sheet of ZNF280A-zinc finger protein 280A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZNF280A-zinc finger protein 280A Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC053901 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZNF280A |
| Origin species: | Human |
| Product name: | ZNF280A-zinc finger protein 280A Gene |
| Size: | 2ug |
| Accessions: | BC053901 |
| Gene id: | 129025 |
| Gene description: | zinc finger protein 280A |
| Synonyms: | 3'OY11.1; SUHW1; ZNF280; ZNF636; zinc finger protein 280A; suppressor of hairy wing homolog 1; zinc finger protein 280; zinc finger protein 636 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggagatatctttttgtgtaagaaagtggaatcaccaaagaagaatttgagagaatccaaacaaagggaggaggatgatgaagatccagatctgatctatgttggggtggagcatgtacatagagatgctgaagttctctttgtcgggatgatttcaaattcaaaaccagtcgtttcaaacattttgaacagagtcaccccaggctcaaattcaagaagaaagaaaggccacttccgtcaatatcctgctcacgtgtcgcagcctgcaaatcatgtgacctctatggcaaaagccatcatgccggtttctctgtctgaggggcgatcgacagatagtcctgtcactatgaagtcttcatctgaacctggttataaaatgagctcaccacaagttgtttctcccagttcctcagactcgctccccccagggactcagtgtctagttggagctatggtctctggaggaggcagaaatgagagttctcctgattcaaagcgactttccacttcagatataaacagcagagattccaaaagggttaaactcagggatggaatcccaggggtaccttctttagctgtggtcccttcagatatgtcttctacaataagcacaaatacaccctcacaggggatctgcaactcatcaaaccatgttcagaatggagtaacatttccttggcctgatgctaatggaaaggcacatttcaatcttacagatccagagagagcaagtgagtctgccctggcaatgacagacatttcaagtctagcaagtcaaaacaagacctttgatcccaagaaagaaaatcccatcgtgttacttagcgacttttactatggacagcataaaggagatgggcagccggaacagaagactcacaccacctttaaatgcctcagctgcgtgaaagttctaaaaaatattaagtttatgaatcacatgaagcatcatttggaatttgagaagcagaggaacgacagctgggaagaccacaccacctgccagcactgccaccggcagtttcccactcccttccagctacagtgtcacattgatagtgtacacatcgccatggggccctctgctgtctgtaaaatctgtgaattgtcatttgaaacagatcaggtcctcttacaacacatgaaggaccatcataagcctggcgaaatgccttatgtgtgccaggtttgccattacagatcgtcggtctttgctgatgtggaaacacattttagaacgtgccatgaaaacacaaagaatttgctttgtctgttttgtctcaaacttttcaaaactgcaataccatacatgaatcattgttggaggcacagcagaaggagggtccttcagtgttccaagtgccggctacagtttttgacgttgaaggaggaaatagagcacaaaaccaaggaccatcaaacatttaaaaagccggagcaactgcaagggttgcctagtgaaacaaaagttattattcaaacttcagttcagccaggatcaagtggtatggcttccgttattgttagcaacactgaccctcagtcttctcctgtaaaaactaaaaagaagacggctatgaacactagagattccagactcccttgcagcaaggattctagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical LOC376693 - collagen, type I, alpha 2 - RNA binding motif protein 4 - casein kinase 1, gamma 2 |