Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HNRNPD-heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) Gene
PTXBC023977
New product
Data sheet of HNRNPD-heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HNRNPD-heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC023977 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HNRNPD |
| Origin species: | Human |
| Product name: | HNRNPD-heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) Gene |
| Size: | 2ug |
| Accessions: | BC023977 |
| Gene id: | 3184 |
| Gene description: | heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) |
| Synonyms: | AUF1A; HNRPD; P37; hnRNPD0; heterogeneous nuclear ribonucleoprotein D0; ARE-binding protein AUFI, type A; AU-rich element RNA binding protein 1, 37kDa; hnRNP D0; heterogeneous nuclear ribonucleoprotein D |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggaggagcagttcggcggggacggggcggcggcagcggcaacggcggcggtaggcggctcggcgggcgagcaggagggagccatggtggcggcgacacagggggcagcggcggcggcgggaagcggagccgggaccgggggcggaaccgcgtctggaggcaccgaagggggcagcgccgagtcggagggggcgaagattgacgccagtaagaacgaggaggatgaaggccattcaaactcctccccacgacactctgaagcagcgacggcacagcgggaagaatggaaaatgtttataggaggccttagctgggacactacaaagaaagatctgaaggactacttttccaaatttggtgaagttgtagactgcactctgaagttagatcctatcacagggcgatcaaggggttttggctttgtgctatttaaagaatcggagagtgtagataaggtcatggatcaaaaagaacataaattgaatgggaaggtgattgatcctaaaagggccaaagccatgaaaacaaaagagccggttaaaaaaatttttgttggtggcctttctccagatacacctgaagagaaaataagggagtactttggtggttttggtgaggtggaatccatagagctccccatggacaacaagaccaataagaggcgtgggttctgctttattacctttaaggaagaagaaccagtgaagaagataatggaaaagaaataccacaatgttggtcttagtaaatgtgaaataaaagtagccatgtcgaaggaacaatatcagcaacagcaacagtggggatctagaggaggatttgcaggaagagctcgtggaagaggtggtgaccagcagagtggttatgggaaggtatccaggcgaggtggtcatcaaaatagctacaaaccatactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2) - ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle - potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 - UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 1 |