Cart 14 Product Products 2 048,37 € (empty)
-
1 x RAB6A-RAB6...113,40 € -
1 x HDHD2-halo...113,40 € -
1 x IDI1-isope...113,40 € -
-
1 x AASDHPPT-a...121,50 € -
1 x OCM-oncomo...113,40 € -
1 x IFNA21-int...113,40 € -
1 x IFNB1-inte...113,40 € -
1 x ABHD14A...259,07 € -
-
1 x DDIT4L-DNA...113,40 € -
1 x APLN-apeli...113,40 € -
1 x UBE2V1-ubi...113,40 € -
No products
To be determined Shipping
2 048,37 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 14 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 048,37 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 048,37 €
Data sheet of BCOR-BCL6 co-repressor Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BCOR-BCL6 co-repressor Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063536 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BCOR |
| Origin species: | Human |
| Product name: | BCOR-BCL6 co-repressor Gene |
| Size: | 2ug |
| Accessions: | BC063536 |
| Gene id: | 54880 |
| Gene description: | BCL6 co-repressor |
| Synonyms: | ANOP2; MAA2; MCOPS2; BCL-6 corepressor; BCL-6 interacting corepressor; BCL6 corepressor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacccacagtgaacttatggaaaagttcttaacagattatttaaatgacctccagggtcgcaatgatgatgacgccagtggcacttgggacttctatggcagctctgtttgtgaaccagatgatgaaagtggctatgatgttttagccaaccccccaggaccagaagaccaggatgatgatgacgatgcctatagcgatgtgtttgaatttgaattttcagagacccccctcttaccgtgttataacatccaagtatctgtggctcaggggccacgaaactggctactgctttcggatgtccttaagaaattgaaaatgtcctcccgcatatttcgctgcaattttccaaacgtggaaattgtcaccattgcagaggcagaattttatcggcaggtttctgcaagtctcttgttctcttgctccaaagacctggaagccttcaaccctgaaagtaaggagctgttagatctggtggaattcacgaacgaaattcagactctgctgggctcctctgtagagtggctccaccccagtgatctggcctcagacaactactggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fidgetin-like 1 - TTK protein kinase - H2.0-like homeobox - tetraspanin 17 |