PTXBC035931
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC035931 |
Product type: | DNA & cDNA |
Ncbi symbol: | HCST |
Origin species: | Human |
Product name: | HCST-hematopoietic cell signal transducer Gene |
Size: | 2ug |
Accessions: | BC035931 |
Gene id: | 10870 |
Gene description: | hematopoietic cell signal transducer |
Synonyms: | KAP10; PIK3AP; hematopoietic cell signal transducer; DNAX-activation protein 10; kinase assoc pro of ~10kDa; kinase assoc protein; membrane protein DAP10; phosphoinositide-3-kinase adaptor protein; transmembrane adapter protein KAP10 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgatccatctgggtcacatcctcttcctgcttttgctcccagtggctgcagctcagacgactccaggagagagatcatcactccctgccttttaccctggcacttcaggctcttgttccggatgtgggtccctctctctgccgctcctggcaggcctcgtggctgctgatgcggtggcatcgctgctcatcgtgggggcggtgttcctgtgcgcacgcccacgccgcagccccgcccaagaagatggcaaagtctacatcaacatgccaggcaggggctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - coiled-coil domain containing 117 - Rho GTPase activating protein 28 - inhibitor of growth family, member 3 - spermatogenesis associated 2-like |