Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
VPS28-vacuolar protein sorting 28 homolog (S. cerevisiae) Gene
PTXBC050713
New product
Data sheet of VPS28-vacuolar protein sorting 28 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VPS28-vacuolar protein sorting 28 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC050713 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VPS28 |
| Origin species: | Human |
| Product name: | VPS28-vacuolar protein sorting 28 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC050713 |
| Gene id: | 51160 |
| Gene description: | vacuolar protein sorting 28 homolog (S. cerevisiae) |
| Synonyms: | VPS28, ESCRT-I subunit; ESCRT-I complex subunit VPS28; vacuolar protein sorting-associated protein 28 homolog; vacuolar protein sorting 28 homolog; vacuolar protein sorting 28-like protein; yeast class E protein Vps28p homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtttcatgggatcccagccacgccgggcataggagcccctgggaacaagccggagctgtatgaggaagtgaagttgtacaagaacgcccgggagagggagaagtacgacaacatggcagagctgtttgcggtggtgaagacaatgcaagccctggagaaggcctacatcaaggactgtgtctcccccagcgagtacactgcagcctgctcccggctcctggtccaatacaaagctgccttcaggcaggtccagggctcagaaatcagctctattgacgaattctgccgcaagttccgcctggactgcccgctggccatggagcggatcaaggaggaccggcccatcaccatcaaggacgacaagggcaacctcaaccgctgcatcgcagacgtggtctcgctcttcatcacggtcatggacaagctgcgcctggagatccgcgccatggatgagatccagcccgacctgcgagagctgatggagaccatgcaccgcatgagccacctcccacccgactttgagggccgccagacggtcagccagtggtgggtgtccctcccagccaggcagagccccgcagtgcccgagaccctcccagccaggcggagccccgcagtgcccctgaggccctcagcccccacatgccctgtgctgcactcccaggctgcagaccctgagcggcatgtcggcgtcagatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vacuolar protein sorting 52 homolog (S. cerevisiae) - ubiquitin associated and SH3 domain containing, A - heterogeneous nuclear ribonucleoprotein U-like 1 - protein tyrosine phosphatase, non-receptor type 11 |