Cart 75 Product Products 27 111,49 € (empty)
-
-
1 x TRIP13-thy...121,50 € -
1 x ELOVL2-elo...121,50 € -
1 x NXPH4-neur...121,50 € -
1 x BIK-BCL2-i...113,40 € -
1 x HPRT1-hypo...113,40 € -
-
-
1 x GRPEL2-Grp...113,40 € -
1 x LENG1-leuk...113,40 € -
1 x UBL5-ubiqu...113,40 € -
1 x RPL23A-rib...113,40 € -
1 x ZNF266-zin...113,40 € -
1 x PGDS-prost...113,40 € -
1 x DLX6-dista...113,40 € -
-
1 x ANKRD22-an...113,40 € -
1 x SSSCA1-Sjo...113,40 € -
1 x SMAP2-smal...121,50 € -
1 x H2AFX-H2A...113,40 € -
1 x CRTAM-cyto...121,50 € -
1 x RPLP2-ribo...113,40 € -
-
1 x ORC4L-orig...113,40 € -
1 x RBPMS-RNA...113,40 € -
1 x MAP2K5-mit...121,50 € -
1 x HLA-DRB3-m...121,50 € -
1 x GATC-gluta...113,40 € -
1 x C7orf44-ch...113,40 € -
1 x APOM-apoli...113,40 € -
1 x PNPLA1-pat...121,50 € -
1 x TPPP-tubul...113,40 € -
1 x BARX1-BARX...113,40 € -
1 x DDA1-DET1...113,40 € -
1 x FGFRL1-fib...121,50 € -
1 x IFNW1-inte...113,40 € -
1 x GSTA4-glut...113,40 € -
1 x PI4KAP1-ph...113,40 € -
-
-
1 x ANKS1B-ank...121,50 € -
1 x JTV1-JTV1...121,50 € -
1 x PPP4R1L-pr...121,50 € -
-
1 x ANXA8L2-an...121,50 € -
1 x SLC37A4-so...121,50 € -
1 x GATA1-GATA...121,50 € -
1 x DOLPP1-dol...113,40 € -
-
-
1 x SEC61A1-Se...121,50 € -
1 x LMX1B...259,07 € -
-
1 x MS4A4A-mem...113,40 € -
1 x RASL11A-RA...113,40 € -
1 x Goat...4 064,52 € -
1 x HPX-hemope...113,40 € -
1 x FOXP1-fork...113,40 € -
1 x FAM98C-fam...113,40 € -
-
1 x RNF182-rin...113,40 € -
1 x LARP1-La...113,40 € -
1 x CBX5-chrom...113,40 € -
1 x SULT1C4-su...113,40 € -
1 x ITM2C-inte...113,40 € -
-
1 x CGB5-chori...113,40 € -
1 x FAHD2A-fum...121,50 € -
1 x GABARAP-GA...113,40 € -
-
-
1 x KCNIP4-Kv...113,40 € -
-
-
1 x C20orf30-c...113,40 €
No products
To be determined Shipping
27 111,49 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 75 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 27 111,49 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 27 111,49 €
View larger 
SLC12A9-solute carrier family 12 (potassium/chloride transporters), member 9 Gene
PTXBC000154
New product
Data sheet of SLC12A9-solute carrier family 12 (potassium/chloride transporters), member 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC12A9-solute carrier family 12 (potassium/chloride transporters), member 9 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC000154 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC12A9 |
| Origin species: | Human |
| Product name: | SLC12A9-solute carrier family 12 (potassium/chloride transporters), member 9 Gene |
| Size: | 2ug |
| Accessions: | BC000154 |
| Gene id: | 56996 |
| Gene description: | solute carrier family 12 (potassium/chloride transporters), member 9 |
| Synonyms: | CCC6; CIP1; WO3.3; hCCC6; solute carrier family 12 member 9; CCC-interacting protein 1; cation-chloride cotransporter 6; cation-chloride cotransporter-interacting protein 1; potassium-chloride transporter 9; solute carrier family 12 (potassium/chloride transporters), member 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccagcgagagctcacctctgctggcctaccggctcctgggggaggagggggttgccctccctgccaatggggccgggggtcctggaggggcgtctgcccggaagctgtccaccttcctgggtgtggtggtgcccactgtcctgtccatgttcagcatagttgtttttctgaggattgatgccacagggcccagtgggctccgggtcctgccccagggctacggctggaacctgctgtatggctccctgctgctgggccttgtgggtggggtctgcaccctgggagccggcctctatgcccgggcctcattcctcacattcctgctggtctctggctccctggcctctgtgctcatcagttttgtggctgtggggccgagggacatccgcttgactcctaggcctggccccaatggctcctccctgccgccccggtttggccacttcaccggcttcaacagcagtaccctgaaggacaacttgggcgctggctatgctgaggactacaccacgggagccgtgatgaattttgccagcgtctttgctgtcctctttaacggctgtacaggcatcatggctggggccaacatgtcaggggagctgaaggaccccagccgggcgatccctctgggcacgatcgtcgccgtcgcctacaccttcttcgtctatgtcctgcttttctttctctccagcttcacttgtgacaggaccctgctgcaggaagactatgggttcttccgcgccatcagcctgtggcccccactggtgttgatcggaatctatgccacagcgctctcagcgtccatgagctcgctcattggtgcctcccgcatcctccatgccctggcccgggatgacctctttggcgtgatcttggcaccggccaaggttgtgtcccgagggggaaacccctgggcagctgtactttattcttggggcctggtgcagctggtgctcctggctgggaagctgaacacactggccgctgtggtcactgtcttctacctggtggcctatgctgccgtggacctgtcctgcctgagcctggagtgggcctcggcccccaacttccgccccaccttcagcctgttctcctggcacacctgcctgctgggggtggcctcctgcctgctcatgatgttcctcatcagtcctggcgcggctggtggctccctgctcctcatgggtctgctggctgccctgctcaccgcgcgaggaggccccagtagctggggctatgtcagccaggccttgcttttccaccaggtgcgtaagtatctgcttcggctggacgtccggaaggatcacgtgaagttctggcggccccagctgctgctcctggtggggaacccccggggcgccctgcctctgctgcggttggccaaccagcttaagaagggggggctgtatgtgctgggccacgtcaccctgggagacctcgactccctgccctcggaccctgtacagccgcagtatggggcatggctcagcctggtggaccgtgcccaggtgaaggcttttgtggatctaaccctctcaccctccgtgcgccagggggctcagcatctgctgcgaatctccggcctcgagtcaaactcgcatcccctgccgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - bone morphogenetic protein receptor, type II (serine/threonine kinase) - Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) - solute carrier family 2 (facilitated glucose transporter), member 13 - solute carrier family 12 (potassium/chloride transporters), member 8 |