Cart 11 Product Products 1 276,99 € (empty)
-
-
1 x PTGR2-pros...121,50 € -
-
1 x PDCL3-phos...113,40 € -
1 x OR10H1-olf...121,50 € -
1 x YIPF2-Yip1...121,50 € -
-
1 x MAPKSP1-MA...113,40 € -
1 x BID-BH3...113,40 € -
1 x CD244-CD24...121,50 € -
1 x PAPLN-papi...113,40 €
No products
To be determined Shipping
1 276,99 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 276,99 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 276,99 €
View larger 
SLC2A6-solute carrier family 2 (facilitated glucose transporter), member 6 Gene
PTXBC013740
New product
Data sheet of SLC2A6-solute carrier family 2 (facilitated glucose transporter), member 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC2A6-solute carrier family 2 (facilitated glucose transporter), member 6 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC013740 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC2A6 |
| Origin species: | Human |
| Product name: | SLC2A6-solute carrier family 2 (facilitated glucose transporter), member 6 Gene |
| Size: | 2ug |
| Accessions: | BC013740 |
| Gene id: | 11182 |
| Gene description: | solute carrier family 2 (facilitated glucose transporter), member 6 |
| Synonyms: | GLUT6; GLUT9; HSA011372; solute carrier family 2, facilitated glucose transporter member 6; GLUT-6; GLUT-9; glucose transporter type 6; glucose transporter type 9; solute carrier family 2 (facilitated glucose transporter), member 6; solute carrier family 2 member 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaggagccgctgctgggagccgagggcccggactacgacaccttccccgagaagccgcccccgtcgccaggggacagggcgcgggtcgggaccctgcagaacaaaagggtgttcctggccaccttcgccgcagtgctcggcaatttcagctttgggtatgccctggtctacacatcccctgtcatcccagccctggagcgctccttggatcctgacctgcatctgaccaaatcccaggcatcctggtttgggtccgtgttcaccctgggagcagcggccggaggcctgagtgccatgatcctcaacgacctcctgggccggaagctgagcatcatgttctcagctgtgccgtcggcggccggctatgcgctcatggcgggtgcgcacggcctctggatgctgctgctcggaaggacgctgacgggcttcgccggggggctcacagctgcctgcatcccggtgtacgtgtctgagattgctcccccaggcgttcgtggggctctgggggccacaccccagctcatggcagtgttcggatccctgtccctctacgcccttggcctcctgctgccgtggcgctggctggctgtggccggggaggcgcctgtgctcatcatgatcctgctgctcagcttcatgcccaactcgccgcgcttcctgctctctcggggcagggacgaagaggccctgcgggcgctggcctggctgcgtgggacggacgtcgatgtccactgggagttcgagcagatccaggacaacgtccggagacagagcagccgagtatcgtgggctgaggcacgggccccccacgtgtgccggcccatcaccgtggccttgctgatgcgcctcctgcagcagctgacgggcatcacgcccatcctggtctacctgcagtccatcttcgacagcaccgctgtcctgctgccccccaaggacgacgcagccatcgttggggccgtgcggctcctgtccgtgctgatcgccgccctcaccatggacctcgcaggccgcaaggtgctgctcttcgtctcagcggccatcatgtttgctgccaacctgactctggggctgtacatccactttggccccaggcctctgagccccaacagcactgcgggcctggaaagcgagtcctggggggacttggcgcagcccctggcagcacccgctggctacctcaccctggtgcccctgctggccaccatgctcttcatcatgggctacgccgtgggctggggtcccatcacctggctgctcatgtctgaggtcctgcccctgcgtgcccgtggcgtggcctcagggctctgcgtgctggccagctggctcaccgccttcgtcctcaccaagtccttcctgccagtggtgagcaccttcggcctccaggtgcctttcttcttcttcgcggccatctgcttggtgagcctggtgttcacaggctgctgtgtgcccgagaccaagggacggtccctggagcagatcgagtccttcttccgcacggggagaaggtccttcttgcgctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium voltage-gated channel, subfamily H (eag-related), member 5 - AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) - COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) - AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) |