Cart 29 Product Products 3 753,17 € (empty)
-
-
1 x TRIP13-thy...121,50 € -
1 x ELOVL2-elo...121,50 € -
1 x NXPH4-neur...121,50 € -
1 x BIK-BCL2-i...113,40 € -
1 x HPRT1-hypo...113,40 € -
-
-
1 x GRPEL2-Grp...113,40 € -
1 x LENG1-leuk...113,40 € -
1 x UBL5-ubiqu...113,40 € -
1 x RPL23A-rib...113,40 € -
1 x ZNF266-zin...113,40 € -
1 x PGDS-prost...113,40 € -
1 x DLX6-dista...113,40 € -
-
1 x ANKRD22-an...113,40 € -
1 x SSSCA1-Sjo...113,40 € -
1 x SMAP2-smal...121,50 € -
1 x H2AFX-H2A...113,40 € -
1 x CRTAM-cyto...121,50 € -
1 x RPLP2-ribo...113,40 € -
-
1 x ORC4L-orig...113,40 € -
1 x RBPMS-RNA...113,40 € -
1 x MAP2K5-mit...121,50 € -
1 x HLA-DRB3-m...121,50 € -
1 x GATC-gluta...113,40 € -
1 x PNPLA1-pat...121,50 €
No products
To be determined Shipping
3 753,17 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 29 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 753,17 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 753,17 €
View larger 
SLC2A12-solute carrier family 2 (facilitated glucose transporter), member 12 Gene
PTXBC070149
New product
Data sheet of SLC2A12-solute carrier family 2 (facilitated glucose transporter), member 12 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC2A12-solute carrier family 2 (facilitated glucose transporter), member 12 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC070149 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC2A12 |
| Origin species: | Human |
| Product name: | SLC2A12-solute carrier family 2 (facilitated glucose transporter), member 12 Gene |
| Size: | 2ug |
| Accessions: | BC070149 |
| Gene id: | 154091 |
| Gene description: | solute carrier family 2 (facilitated glucose transporter), member 12 |
| Synonyms: | GLUT8; solute carrier family 2, facilitated glucose transporter member 12; GLUT-12; glucose transporter type 12; solute carrier family 2 (facilitated glucose transporter), member 12; solute carrier family 2 member 12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtacctgttgaaaacaccgagggccccagtctgctgaaccagaaggggacagccgtggagacggagggcagcggcagccggcatcctccctgggcgagaggctgcggcatgtttaccttcctgtcatctgtcactgctgctgtcagtggcctcctggtgggttatgaacttgggatcatctctggggctcttcttcagatcaaaaccttattagccctgagctgccatgagcaggaaatggttgtgagctccctcgtcattggagccctccttgcctcactcaccggaggggtcctgatagacagatatggaagaaggacagcaatcatcttgtcatcctgcctgcttggactcggaagcttagtcttgatcctcagtttatcctacacggttcttatagtgggacgcattgccataggggtctccatctccctctcttccattgccacttgtgtttacatcgcagagattgctcctcaacacagaagaggccttcttgtgtcactgaatgagctgatgattgtcatcggcattctttctgcctatatttcaaattacgcatttgccaatgttttccatggctggaagtacatgtttggtcttgtgattcccttgggagttttgcaagcaattgcaatgtattttcttcctccaagccctcggtttctggtgatgaaaggacaagagggagctgctagcaaggttcttggaaggttaagagcactctcagatacaactgaggaactcactgtgatcaaatcctccctgaaagatgaatatcagtacagtttttgggatctgtttcgttcaaaagacaacatgcggacccgaataatgataggactaacactagtattttttgtacaaatcactggccaaccaaacatattgttctatgcatcaactgttttgaagtcagttggatttcaaagcaatgaggcagctagcctcgcctccactggggttggagtcgtcaaggtcattagcaccatccctgccactcttcttgtagaccatgttggcagcaaaacattcctctgcattggctcctctgtgatggcagcttcgttggtgaccatgggcatcgtaaatctcaacatccacatgaacttcacccatatctgcagaagccacaattctatcaaccagtccttggatgagtctgtgatttatggaccaggaaacctgtcaaccaacaacaatactctcagagaccacttcaaagggatttcttcccatagcagaagctcactcatgcccctgagaaatgatgtggataagagaggggagacgacctcagcatccttgctaaatgctggattaagccacactgaataccagatagtcacagaccctggggacgtcccagcttttttgaaatggctgtccttagccagcttgcttgtttatgttgctgctttttcaattggtctaggaccaatgccctggctggtgctcagcgagatctttcctggtgggatcagaggacgagccatggctttaacttctagcatgaactggggcatcaatctcctcatctcgctgacatttttgactgtaactgatcttattggcctgccatgggtgtgctttatatatacaatcatgagtctagcatccctgctttttgttgttatgtttatacctgagacaaagggatgctctttggaacaaatatcaatggagctagcaaaagtgaactatgtgaaaaacaacatttgttttatgagtcatcaccaagaagaattagtgccaaaacagcctcaaaaaagaaaaccccaggagcagctcttggagtgtaacaagctgtgtggtaggggccaatccaggcagctttctccagagacctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 12 (potassium/chloride transporters), member 9 - bone morphogenetic protein receptor, type II (serine/threonine kinase) - Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) - solute carrier family 2 (facilitated glucose transporter), member 13 |