> >>MRAP-melanocortin 2 receptor accessory protein Gene
MRAP-melanocortin 2 receptor accessory protein Gene View larger

MRAP-melanocortin 2 receptor accessory protein Gene

PTXBC062721

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of MRAP-melanocortin 2 receptor accessory protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRAP-melanocortin 2 receptor accessory protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC062721
Product type: DNA & cDNA
Ncbi symbol: MRAP
Origin species: Human
Product name: MRAP-melanocortin 2 receptor accessory protein Gene
Size: 2ug
Accessions: BC062721
Gene id: 56246
Gene description: melanocortin 2 receptor accessory protein
Synonyms: B27; C21orf61; FALP; FGD2; GCCD2; melanocortin-2 receptor accessory protein; fat cell-specific low molecular weight protein; fat tissue-specific low MW protein; melanocortin 2 receptor accessory protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaacgggaccaacgcctctgccccatactacagctatgaatactacctggactatctggacctcattcccgtggacgagaagaagctgaaagcccacaaacattccatcgtgatcgcattctgggttagcctggctgccttcgtggtgctgctcttcctcatcttgctctacatgtcctggtccgcctccccgcagatgaggaacagccccaagcaccaccaaacatgcccctggagtcacggcctcaacctccacctctgcatccagaagtgcctgccgtgccacagggaacccctggcaacctcacaggctcaggcgagctcagtggagccagggagcagaactggccctgaccagccgctacgacaggagagctcctccacgttgcccctcgggggtttccagacccaccccactctcctctgggaactgaccctcaatgggggtcccctcgtcaggagcaagcccagcgagcctccccctggagacaggacctctcaattgcagagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - OTU domain, ubiquitin aldehyde binding 2
- coiled-coil and C2 domain containing 1B
- breast cancer anti-estrogen resistance 3
- chromosome 20 open reading frame 132

Reviews

Buy MRAP-melanocortin 2 receptor accessory protein Gene now

Add to cart