Cart 19 Product Products 2 919,62 € (empty)
-
1 x CLEC7A-C-t...113,40 € -
1 x CNOT8-CCR4...121,50 € -
-
-
1 x SH2D1B-SH2...113,40 € -
1 x TMOD2-trop...121,50 € -
1 x ANAPC13-an...113,40 € -
1 x TMEM60-tra...113,40 € -
1 x TBX10-T-bo...121,50 € -
1 x Phospho-In...259,07 € -
-
-
1 x HEY1-hairy...121,50 € -
1 x CLEC3A-C-t...113,40 € -
1 x HERC6-hect...121,50 € -
1 x CLEC4M-C-t...121,50 € -
-
-
1 x Trail...534,00 €
No products
To be determined Shipping
2 919,62 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 19 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 919,62 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 919,62 €
Data sheet of RP13-36C9.6-cancer/testis antigen CT45-5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RP13-36C9.6-cancer/testis antigen CT45-5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC070138 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RP13-36C9.6 |
| Origin species: | Human |
| Product name: | RP13-36C9.6-cancer/testis antigen CT45-5 Gene |
| Size: | 2ug |
| Accessions: | BC070138 |
| Gene id: | 441521 |
| Gene description: | cancer/testis antigen CT45-5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccgataaaacagagaaggtggctgtagatcctgaaactgtgtttaaacgtcccagggaatgtgacagtccttcgtatcagaaaaggcagaggatggccctgttggcaaggaaacaaggagcaggagacagccttattgcaggctctgccatgtccaaagaaaagaagcttatgacaggacatgctattccacccagccaattggattctcagattgatgacttcactggtttcagcaaagatgggatgatgcagaaacctggtagcaatgcacctgtgggaggaaatgttaccagcaatttctctggagatgacctagaatgcagaggaatagcctcctctcccaaaagccaacaagaaattaatgctgatataaaatgtcaagtagtgaaggaaatccgatgccttggacgaaaatatgaaaaaatcttcgaaatgcttgaaggagtgcaaggacctactgcagtcaggaaacgattttttgaatccatcatcaaggaagcagcaagatgtatgagacgagactttgttaagcaccttaagaagaaactgaaacgtatgatttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - retinol binding protein 2, cellular - mitogen-activated protein kinase 7 - chromosome 9 open reading frame 6 - suppressor of cytokine signaling 6 |