Cart 4 Product Products 486,00 € (empty)
-
1 x FLJ10404-h...121,50 € -
1 x GALT-galac...121,50 € -
1 x TPH2-trypt...121,50 € -
1 x IMP4-IMP4,...121,50 €
No products
To be determined Shipping
486,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 486,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 486,00 €
View larger 
Data sheet of RTP2-receptor (chemosensory) transporter protein 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RTP2-receptor (chemosensory) transporter protein 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC068081 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RTP2 |
| Origin species: | Human |
| Product name: | RTP2-receptor (chemosensory) transporter protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC068081 |
| Gene id: | 344892 |
| Gene description: | receptor (chemosensory) transporter protein 2 |
| Synonyms: | Z3CXXC2; receptor-transporting protein 2; 3CxxC-type zinc finger protein 2; receptor (chemosensory) transporter protein 2; zinc finger, 3CxxC-type 2; receptor transporter protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgtaccagcttgaccacttgtgagtggaagaaagtcttctatgagaagatggaggtggcaaagccagcggacagctgggagctcatcatagaccccaacctcaagcccagtgagctggcccctggctggaagcagtacctggagcagcacgcctcaggcaggttccactgctcctggtgctggcacacctggcagtctgcccatgtggtcatcctcttccacatgttcctggaccgcgcccggcgggcgggctcggtgcgcatgcgcgtcttcaagcagctgtgctatgagtgcggcacggcgcggctggacgagtccagcatgcttgaggagaacatcgagggcctggtggacaacctcatcaccagcctgcgcgagcagtgctacgaggaggatggtggccagtaccgcatccacgtggccagccgcccggacagcgggccgcatcgtgcagagttctgtgaggcctgccaggagggcatcgttcactggaagcccagcgagaagctgctggaggaggaggtgaccacctacacctctgaagcctccaagccgagggcccaggcgggatccggctacaacttcttgtctcttcgctggtgcctcttctgggcctctctctgcctgctcgttgtttacctgcagttctccttcctcagtcctgccttcttttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chaperonin containing TCP1, subunit 8 (theta) - alkB, alkylation repair homolog 3 (E. coli) - sodium channel, voltage-gated, type II, beta - arginine-rich, mutated in early stage tumors |