BOLA2-bolA homolog 2 (E. coli) Gene View larger

BOLA2-bolA homolog 2 (E. coli) Gene

PTXBC062756

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BOLA2-bolA homolog 2 (E. coli) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BOLA2-bolA homolog 2 (E. coli) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC062756
Product type: DNA & cDNA
Ncbi symbol: BOLA2
Origin species: Human
Product name: BOLA2-bolA homolog 2 (E. coli) Gene
Size: 2ug
Accessions: BC062756
Gene id: 552900
Gene description: bolA homolog 2 (E. coli)
Synonyms: BOLA2A; BOLA2B; My016; bolA-like protein 2; BolA-like protein 2 member A; bolA homolog 2; bolA family member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaactcagcgccgaatacctccgcgagaagctgcagcgggacctggaggcggagcatgtggaggtggaggacacgaccctcaaccgttgctcctgtagcttccgagtcctggtggtgtcggccaagttcgaggggaaaccgctgcttcagagacacaggttctgtacagagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 768
- zinc finger protein 250
- kinesin family member 12
- zinc finger protein 254

Reviews

Buy BOLA2-bolA homolog 2 (E. coli) Gene now

Add to cart