Cart 8 Product Products 1 228,07 € (empty)
-
-
-
-
-
-
1 x HEYL-hairy...121,50 € -
1 x ABHD2-abhy...121,50 € -
No products
To be determined Shipping
1 228,07 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 228,07 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 228,07 €
Data sheet of PRAP1-proline-rich acidic protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRAP1-proline-rich acidic protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC071872 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRAP1 |
| Origin species: | Human |
| Product name: | PRAP1-proline-rich acidic protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC071872 |
| Gene id: | 118471 |
| Gene description: | proline-rich acidic protein 1 |
| Synonyms: | PRO1195; UPA; proline-rich acidic protein 1; epididymis tissue protein Li 178; proline rich acidic protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggaggctcctcctggtcaccagcctggtggttgtgctgctgtgggaggcaggtgcagtcccagcacccaaggtccctatcaagatgcaagtcaaacactggccctcagagcaggacccagagaaggcctggggcgcccgtgtggtggagcctccggagaaggacgaccagctggtggtgctgttccctgtccagaagccgaaactcttgaccaccgaggagaagccacgaggtcagggcaggggccccatccttccaggcaccaaggcctggatggagaccgaggacaccctgggccgtgtcctgagtcccgagcccgaccatgacagcctgtaccaccctccgcctgaggaggaccagggcgaggagaggccccggttgtgggtgatgccaaatcaccaggtgctcctgggaccggaggaagaccaagaccacatctaccacccccagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TBC1 domain family, member 2 - TAP binding protein (tapasin) - pre-B-cell leukemia homeobox 2 - complement factor H-related 3 |