Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CRP-C-reactive protein, pentraxin-related Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CRP-C-reactive protein, pentraxin-related Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC070257 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CRP |
| Origin species: | Human |
| Product name: | CRP-C-reactive protein, pentraxin-related Gene |
| Size: | 2ug |
| Accessions: | BC070257 |
| Gene id: | 1401 |
| Gene description: | C-reactive protein, pentraxin-related |
| Synonyms: | PTX1; C-reactive protein; C-reactive protein, pentraxin-related; pentraxin 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgggactttgtgctgtcaccagatgagattaacaccatctatcttggcgggcccttcagtcctaatgtcctgaactggcgggcactgaagtatgaagtgcaaggcgaagtgttcaccaaaccccagctgtggccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - inhibitor of growth family, member 5 - SRY (sex determining region Y)-box 7 - primase, DNA, polypeptide 2 (58kDa) - hematopoietic cell signal transducer |