Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ADAM33-ADAM metallopeptidase domain 33 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ADAM33-ADAM metallopeptidase domain 33 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC062663 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ADAM33 |
| Origin species: | Human |
| Product name: | ADAM33-ADAM metallopeptidase domain 33 Gene |
| Size: | 2ug |
| Accessions: | BC062663 |
| Gene id: | 80332 |
| Gene description: | ADAM metallopeptidase domain 33 |
| Synonyms: | C20orf153; DJ964F7.1; disintegrin and metalloproteinase domain-containing protein 33; ADAM 33; a disintegrin and metalloprotease 33; a disintegrin and metalloproteinase domain 33; disintegrin and reprolysin metalloproteinase family protein; ADAM metallopeptidase domain 33 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggctggaggccccggagagctcgggggaccccgttgctgctgctgctactactgctgctgctctggccagtgccaggcgccggggtgcttcaaggacatatccctgggcagccagtcaccccgcactgggtcctggatggacaaccctggcgcaccgtcagcctggaggagccggtctcgaagccagacatggggctggtggccctggaggctgaaggccaggagctcctgcttgagctggagaagaaccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ADAM metallopeptidase domain 18 - TNF receptor-associated factor 6 - timeless homolog (Drosophila) - calcium homeostasis modulator 3 |