Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of M6PR-mannose-6-phosphate receptor (cation dependent) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about M6PR-mannose-6-phosphate receptor (cation dependent) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC024206 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | M6PR |
| Origin species: | Human |
| Product name: | M6PR-mannose-6-phosphate receptor (cation dependent) Gene |
| Size: | 2ug |
| Accessions: | BC024206 |
| Gene id: | 4074 |
| Gene description: | mannose-6-phosphate receptor (cation dependent) |
| Synonyms: | CD-M6PR; CD-MPR; MPR 46; MPR-46; MPR46; SMPR; cation-dependent mannose-6-phosphate receptor; 46-kDa mannose 6-phosphate receptor; CD Man-6-P receptor; Mr 46,000 Man6PR; small mannose 6-phosphate receptor; mannose-6-phosphate receptor, cation dependent |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttccctttctacagctgctggaggactggactgctactactactcctggctgtggcagtgagagaatcctggcagacagaagaaaaaacttgcgacttggtaggagaaaagggtaaagagtcagagaaagagttggctctagtgaagaggctgaaaccactgtttaataaaagctttgagagcactgtgggccagggttcagacacatacatctacatcttcagggtgtgccgggaagctggcaaccacacttctggggcaggcctggtgcaaatcaacaaaagtaatgggaaggagacagtggtagggagactcaacgagactcacatcttcaacggaagtaattggatcatgctgatctataaagggggtgatgaatatgacaaccactgtggcaaggagcagcgtcgtgcagtggtgatgatctcctgcaatcgacacaccctagcggacaattttaaccctgtgtctgaggagcgtggcaaagtccaagattgtttctacctctttgagatggatagcagcctggcctgttcaccagagatctcccacctcagtgtgggttccatcttacttgtcacgtttgcatcactggttgctgtttatgttgttggggggttcctataccagcgactggtagtgggagccaaaggaatggagcagtttccccacttagccttctggcaggatcttggcaacctggtagcagatggctgtgactttgtctgccgttctaaacctcgaaatgtgcctgcagcatatcgtggtgtgggggatgaccagctgggggaggagtcagaagaaagggatgaccatttattaccaatgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - spectrin repeat containing, nuclear envelope 2 - ferritin, heavy polypeptide-like 3 pseudogene - protein tyrosine phosphatase, receptor type, F - ClpB caseinolytic peptidase B homolog (E. coli) |