Cart 13 Product Products 1 963,15 € (empty)
-
-
1 x MGC9913-hy...113,40 € -
1 x DDOST-doli...121,50 € -
1 x GPR82-G...121,50 € -
1 x LOC440905-...113,40 € -
1 x MGC16075-h...113,40 € -
1 x FGFBP1-fib...113,40 € -
1 x CREB3L2-cA...113,40 € -
1 x SNAPC5-sma...113,40 € -
1 x CERK-ceram...113,40 € -
1 x VPS24-vacu...113,40 € -
1 x DMC1-DMC1...121,50 € -
1 x MYBPC3...259,07 €
No products
To be determined Shipping
1 963,15 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 963,15 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 963,15 €
Data sheet of TNMD-tenomodulin Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNMD-tenomodulin Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034030 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNMD |
| Origin species: | Human |
| Product name: | TNMD-tenomodulin Gene |
| Size: | 2ug |
| Accessions: | BC034030 |
| Gene id: | 64102 |
| Gene description: | tenomodulin |
| Synonyms: | BRICD4; CHM1L; TEM; tenomodulin; BRICHOS domain containing 4; chondromodulin-1-like protein; chondromodulin-I-like protein; chondromodulin-IB; hChM1L; hTeM; myodulin; tendin |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaaagaatcctccagagaattgtgaagactgtcacattctaaatgcagaagcttttaaatccaagaaaatatgtaaatcacttaagatttgtggactggtgtttggtatcctggccctaactctaattgtcctgttttgggggagcaagcacttctggccggaggtacccaaaaaagcctatgacatggagcacactttctacagcaatggagagaagaagaagatttacatggaaattgatcctgtgaccagaactgaaatattcagaagcggaaatggcactgatgaaacattggaagtgcacgactttaaaaacggatacactggcatctacttcgtgggtcttcaaaaatgttttatcaaaactcagattaaagtgattcctgaattttctgaaccagaagaggaaatagatgagaatgaagaaattaccacaactttctttgaacagtcagtgatttgggtcccagcagaaaagcctattgaaaaccgagattttcttaaaaattccaaaattctggagatttgtgataacgtgaccatgtattggatcaatcccactctaatatcaggtatgacattcttatcctcatcctcctcctattttctaagacagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cystatin SA - keratin 17 - annexin A8 - reticulon 4 |