Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RUVBL2-RuvB-like 2 (E. coli) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RUVBL2-RuvB-like 2 (E. coli) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008355 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RUVBL2 |
| Origin species: | Human |
| Product name: | RUVBL2-RuvB-like 2 (E. coli) Gene |
| Size: | 2ug |
| Accessions: | BC008355 |
| Gene id: | 10856 |
| Gene description: | RuvB-like 2 (E. coli) |
| Synonyms: | CGI-46; ECP-51; ECP51; INO80J; REPTIN; RVB2; TAP54-beta; TIH2; TIP48; TIP49B; ruvB-like 2; 48 kDa TATA box-binding protein-interacting protein; 48 kDa TBP-interacting protein; 51 kDa erythrocyte cytosolic protein; INO80 complex subunit J; RuvB (E coli homolog)-like 2; TIP60-associated protein 54-beta; erythrocyte cytosolic protein, 51-KD; repressing pontin 52; reptin52 protein; RuvB like AAA ATPase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaaccgttacagccacaaccaaagtcccggagatccgtgatgtaacaaggattgagcgaatcggtgcccactcccacatccggggactggggctggacgatgccttggagcctcggcaggcttcgcaaggcatggtgggtcagctggcggcacggcgggcggctggcgtggtgctggagatgatccgggaagggaagattgccggtcgggcagtccttattgctggccagccgggcacggggaagacggccatcgccatgggcatggcgcaggccctgggccctgacacgccattcacagccatcgccggcagtgaaatcttctccctggagatgagcaagaccgaggcgctgacgcaggccttccggcggtccatcggcgttcgcatcaaggaggagacggagatcatcgaaggggaggtggtggagatccagattgatcgaccagcaacagggacgggctccaaggtgggcaaactgaccctcaagaccacagagatggagaccatctacgacctgggcaccaagatgattgagtccctgaccaaggacaagggacgtgatcaccatcgacaaggcgacgggcaagatctccaagttgggccgctccttcacacgcgcccgcgactacgacgctatgggctcccagaccaagttcgtgcagtgcccagatggggagctccagaaacgcaaggaggtggtgcacaccgtgtccctgcacgagatcgacgtcatcaactctcgcacccagggcttcctggcgctcttctcaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ankyrin 1, erythrocytic - zinc finger protein 77 - LYR motif containing 5 - cardiolipin synthase 1 |