Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CYP27B1-cytochrome P450, family 27, subfamily B, polypeptide 1 Gene
PTXBC001776
New product
Data sheet of CYP27B1-cytochrome P450, family 27, subfamily B, polypeptide 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CYP27B1-cytochrome P450, family 27, subfamily B, polypeptide 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001776 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CYP27B1 |
| Origin species: | Human |
| Product name: | CYP27B1-cytochrome P450, family 27, subfamily B, polypeptide 1 Gene |
| Size: | 2ug |
| Accessions: | BC001776 |
| Gene id: | 1594 |
| Gene description: | cytochrome P450, family 27, subfamily B, polypeptide 1 |
| Synonyms: | CP2B; CYP1; CYP1alpha; CYP27B; P450c1; PDDR; VDD1; VDDR; VDDRI; VDR; 25-hydroxyvitamin D-1 alpha hydroxylase, mitochondrial; 1alpha(OH)ase; 25 hydroxyvitamin D3-1-alpha hydroxylase; 25-OHD-1 alpha-hydroxylase; VD3 1A hydroxylase; calcidiol 1-monooxygenase; cytochrome P450 subfamily XXVIIB polypeptide 1; cytochrome P450, family 27, |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacccagaccctcaagtacgcctccagagtgttccatcgcgtccgctgggcgcccgagttgggcgcctccctaggctaccgagagtaccactcagcacgccggagcttggcagacatcccaggcccctctacgcccagctttctggccgaacttttctgcaagggggggctgtcgaggctacacgagctgcaggtgcagggcgccgcgcacttcgggccggtgtggctagccagctttgggacagtgcgcaccgtgtacgtggctgcccctgcactcgtcgaggagctgctgcgacaggagggaccccggcccgagcgctgcagcttctcgccctggacggagcaccgccgctgccgccagcgggcttgcggactgctcactgcggaaggcgaagaatggcaaaggctccgcagtctcctggccccgctcctcctccggcctcaagcggccgcccgctacgccggaaccctgaacaacgtagtctgcgaccttgtgcggcgtctgaggcgccagcggggacgtggcacggggccgcccgccctggttcgggacgtggcgggggaattttacaagttcggactggaaggtgagtcccaggacagagctgggcaggcgtcgggggcgccctaccagagcctcccggaaccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - MRS2 magnesium homeostasis factor homolog (S. cerevisiae) - cytochrome P450, family 17, subfamily A, polypeptide 1 - poly(A) binding protein, cytoplasmic 4 (inducible form) - protein-L-isoaspartate (D-aspartate) O-methyltransferase |