UBAC2-UBA domain containing 2 Gene View larger

UBAC2-UBA domain containing 2 Gene

PTXBC072674

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBAC2-UBA domain containing 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBAC2-UBA domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC072674
Product type: DNA & cDNA
Ncbi symbol: UBAC2
Origin species: Human
Product name: UBAC2-UBA domain containing 2 Gene
Size: 2ug
Accessions: BC072674
Gene id: 337867
Gene description: UBA domain containing 2
Synonyms: PHGDHL1; ubiquitin-associated domain-containing protein 2; RP11-178C10.1; UBA domain-containing protein 2; phosphoglycerate dehydrogenase like 1; phosphoglycerate dehydrogenase-like protein 1; UBA domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccggtctgtgctacgacagcaaaatgttccaggtgcatcaggtgctctgcatccccagctggatggcaaaattcttttcttggacacttgaacccatcttctcttcttcagaacccaccagcgaagccagaattgggatgggagccacgctggacatccagagacagcagagaatggagctgctggaccggcagctgatgttctctcagtttgcacaagggaggcgacagagacagcagcagggaggaatgatcaattggaatcgtctttttcctcctttacgtcagcgacaaaacgtaaactatcagggcggtcggcagtctgagccagcagcgccccctctagaagtttctgaggaacaggtcgcccggctcatggagatgggattttccagaggtgatgctttggaagccctgagagcttcaaacaatgacctcaatgtcgccaccaacttcctgctgcagcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - growth arrest-specific 2
- ribosomal protein L13a
- leucine aminopeptidase 3
- protein kinase C, delta

Reviews

Buy UBAC2-UBA domain containing 2 Gene now

Add to cart