Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of UGCGL2-UDP-glucose ceramide glucosyltransferase-like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UGCGL2-UDP-glucose ceramide glucosyltransferase-like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC067807 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UGCGL2 |
| Origin species: | Human |
| Product name: | UGCGL2-UDP-glucose ceramide glucosyltransferase-like 2 Gene |
| Size: | 2ug |
| Accessions: | BC067807 |
| Gene id: | 55757 |
| Gene description: | UDP-glucose ceramide glucosyltransferase-like 2 |
| Synonyms: | UGCGL2; HUGT2; UGT2; UDP-glucose:glycoprotein glucosyltransferase 2; UDP-Glc:glycoprotein glucosyltransferase 2; UDP-glucose ceramide glucosyltransferase-like 1; UDP-glucose ceramide glucosyltransferase-like 2; UDP-glucose glycoprotein glucosyltransferase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgccagcgaaagccacgaacgtggtgcggctgctactaggctccacagcgctgtggctttcgcagctcggctccgggacggtcgccgcgtccaagtcggtgactgcccacttggccgcgaagtggcccgagaccccgctgctgctggaggcaagtgaatttatggcagaagaaagtaatgaaaaattttggcagtttttggaaactgtgcaagaattagcaatttataagcaaacagaatcagattattcttattacaacttaatcctgaagaaagctggacagtttctagacaatttacacatcaaccttttaaagtttgctttctctataagggcatactcccgagctattcagatgtttcagcagattgcagctgatgagccaccaccagatggttgtaatgcatttgtggttattcataagaagcacacctgtaaaattaatgagattaaaaagctgctgaagaaagctgcttcaaggactagaccttatctatttaaaggagatcacaaatttcctacaaacaaagagaacttaccagtggtgattctctatgccgaaatgggtactagaacatttagtgcatttcacaaagtattgtctgaaaaagctcaaaatgaggaaattctgtatgttcttcgccattatattcagaaaccaagctcacggaaaatgtacttatctgggtatggtgtggagctagcaattaagagtacagaatacaaagcactggatgatacccaagttaaaactgtgactaatactactgtagaggatgagactgaaacaaatgaagttcaaggatttctctttgggaaactaaagcttgtctattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanylate binding protein 2, interferon-inducible - CDC42 effector protein (Rho GTPase binding) 4 - protein tyrosine phosphatase type IVA, member 2 - CLCA family member 2, chloride channel regulator |