Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HMGB3-high-mobility group box 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HMGB3-high-mobility group box 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC070482 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HMGB3 |
| Origin species: | Human |
| Product name: | HMGB3-high-mobility group box 3 Gene |
| Size: | 2ug |
| Accessions: | BC070482 |
| Gene id: | 3149 |
| Gene description: | high-mobility group box 3 |
| Synonyms: | HMG-2a; HMG-4; HMG2A; HMG4; high mobility group protein B3; high mobility group protein 2a; high-mobility group (nonhistone chromosomal) protein 4; high mobility group box 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctaaaggtgaccccaagaaaccaaagggcaagatgtccgcttatgccttctttgtgcagacatgcagagaagaacataagaagaaaaacccagaggtccctgtcaattttgcggaattttccaagaagtgctctgagaggtggaagacgatgtccgggaaagagaaatctaaatttgatgaaatggcaaaggcagataaagtgcgctatgatcgggaaatgaaggattatggaccagctaagggaggcaagaagaagaaggatcctaatgctcccaaaaggccaccgtctggattcttcctgttctgttcagaattccgccccaagatcaaatccacaaaccccggcatctctattggagacgtggcaaaaaagctgggtgagatgtggaataatttaaatgacagtgaaaagcagccttacatcactaaggcggcaaagctgaaggagaagtatgagaaggatgttgctgactataagtcgaaaggaaagtttgatggtgcaaagggtcctgctaaagttgcccggaaaaaggtggaagaggaagatgaagaagaggaggaggaagaagaggaggaggaggaggaggaggatgaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - aquaporin 7 pseudogene 2 - stathmin 1/oncoprotein 18 - SFT2 domain containing 2 - high-mobility group box 4 |