IL17A-interleukin 17A Gene View larger

IL17A-interleukin 17A Gene

PTXBC066251

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IL17A-interleukin 17A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IL17A-interleukin 17A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC066251
Product type: DNA & cDNA
Ncbi symbol: IL17A
Origin species: Human
Product name: IL17A-interleukin 17A Gene
Size: 2ug
Accessions: BC066251
Gene id: 3605
Gene description: interleukin 17A
Synonyms: CTLA-8; CTLA8; IL-17A; IL17; interleukin-17A; cytotoxic T-lymphocyte-associated antigen 8; cytotoxic T-lymphocyte-associated protein 8; interleukin 17 (cytotoxic T-lymphocyte-associated serine esterase 8); interleukin 17A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactcctgggaagacctcattggtatcactgctactgctgctgagcctggaggccatagtgaaggcaggaatcacaatcccacgaaatccaggatgcccaaattctgaggacaagaacttcccccggactgtgatggtcaacctgaacatccataaccggaataccaataccaatcccaaaaggtcctcagattactacaaccgatccacctcaccttggaatctccaccgcaatgaggaccctgagagatatccctctgtgatctgggaggcaaagtgccgccacttgggctgcatcaacgctgatgggaacgtggactaccacatgaactctgtccccatccagcaagagatcctggtcctgcgcagggagcctccacactgccccaactccttccggctggagaagatactggtgtccgtgggctgcacctgtgtcaccccgattgtccaccatgtggcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - EPH receptor B2
- angiopoietin 1
- interleukin 17F
- laminin, beta 3

Reviews

Buy IL17A-interleukin 17A Gene now

Add to cart