HIST1H2AJ-histone cluster 1, H2aj Gene View larger

HIST1H2AJ-histone cluster 1, H2aj Gene

PTXBC066234

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HIST1H2AJ-histone cluster 1, H2aj Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HIST1H2AJ-histone cluster 1, H2aj Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC066234
Product type: DNA & cDNA
Ncbi symbol: HIST1H2AJ
Origin species: Human
Product name: HIST1H2AJ-histone cluster 1, H2aj Gene
Size: 2ug
Accessions: BC066234
Gene id: 8331
Gene description: histone cluster 1, H2aj
Synonyms: H2A/E; H2AFE; dJ160A22.4; histone cluster 1, H2aj; H2A histone family, member E; histone 1, H2aj; histone cluster 1 H2A family member j
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgggcgtggtaagcagggaggcaaagctcgcgccaaggccaagacccgctcttctcgggccgggcttcagtttcccgtaggccgagtgcatcgcctgctccgcaaaggcaactatgcggagcgggtcggtgctggagcgccggtatacctggcggcggtgctggagtacctgaccgccgagatcctggagctggctggcaacgcggcccgcgacaacaagaagactcgcatcatcccgcgtcacctccagctggccatccgcaacgatgaggagctcaacaagcttctgggcaaagtcaccatcgcacagggtggcgtcctgcccaacatccaggccgtgctgctgccaaagaaaactgagagccaccacaagactaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 3-oxoacid CoA transferase 2
- aspartate dehydrogenase
- leiomodin 1 (smooth muscle)
- ataxia telangiectasia mutated

Reviews

Buy HIST1H2AJ-histone cluster 1, H2aj Gene now

Add to cart