Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ITGA4-integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) Gene
PTXBC080190
New product
Data sheet of ITGA4-integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ITGA4-integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC080190 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ITGA4 |
| Origin species: | Human |
| Product name: | ITGA4-integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) Gene |
| Size: | 2ug |
| Accessions: | BC080190 |
| Gene id: | 3676 |
| Gene description: | integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) |
| Synonyms: | CD49D; IA4; integrin alpha-4; 269C wild type; CD49 antigen-like family member D; VLA-4 subunit alpha; alpha 4 subunit of VLA-4 receptor; antigen CD49D, alpha-4 subunit of VLA-4 receptor; integrin alpha-IV; very late activation protein 4 receptor, alpha 4 subunit; integrin subunit alpha 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacaatctaaagcacagcagagtgactgtagcaatacctttaaaatatgaggttaagctgactgttcatgggtttgtaaacccaacttcatttgtgtatggatcaaatgatgaaaatgagcctgaaacgtgcatggtggagaaaatgaacttaactttccatgttatcaacactggcaatagtatggctcccaatgttagtgtggaaataatggtaccaaattcttttagcccccaaactgataagctgttcaacattttggatgtccagactactactggagaatgccactttgaaaattatcaaagagtgtgtgcattagagcagcaaaagagtgcaatgcagaccttgaaaggcatagtccagttcttgtccaagactgataagaggctattgtactgcataaaagctgatccacattgtttaaatttcttgtgtaattttgggaaaatggaaagtggaaaagaagccagtgttcatatccaactggaaggccggccatccattttagaaatggatgagacttcagcactcaagtttgaaataagagcaacaggttttccagagccaaatccaagagtaattgaactaaacaaggatgagaatgttgcgcatgttctactggaaggactacatcatcaaagacccaaacgttatttcaccatagtgattatttcaagtagcttgctacttggacttattgtacttctgttgatctcatatgttatgtggaaggctggcttctttaaaagacaatacaaatctatcctacaagaagaaaacagaagagacagttggagttatatcaacagtaaaagcaatgatgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - FCF1 small subunit (SSU) processome component homolog (S. cerevisiae) - solute carrier family 2 (facilitated glucose transporter), member 6 - potassium voltage-gated channel, subfamily H (eag-related), member 5 - AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) |