IL26-interleukin 26 Gene View larger

IL26-interleukin 26 Gene

PTXBC066271

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IL26-interleukin 26 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IL26-interleukin 26 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC066271
Product type: DNA & cDNA
Ncbi symbol: IL26
Origin species: Human
Product name: IL26-interleukin 26 Gene
Size: 2ug
Accessions: BC066271
Gene id: 55801
Gene description: interleukin 26
Synonyms: AK155; IL-26; interleukin-26; interleukin 26
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggtgaatttcattttgaggtgtgggttgctgttagtcactctgtctcttgccattgccaagcacaagcaatcttccttcaccaaaagttgttacccaaggggaacattgtcccaagctgttgacgctctctatatcaaagcagcatggctcaaagcaacgattccagaagaccgcataaaaaatatacgattattaaaaaagaaaacaaaaaagcagtttatgaaaaactgtcaatttcaagaacagcttctgtccttcttcatggaagacgtttttggtcaactgcaattgcaaggctgcaagaaaatacgctttgtggaggactttcatagccttaggcagaaattgagccactgtatttcctgtgcttcatcagctagagagatgaaatccattaccaggatgaaaagaatattttataggattggaaacaaaggaatttacaaagccatcagtgaactggatattcttctttcctggattaaaaaattattggaaagcagtcagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - homeobox A10
- interleukin 27
- thrombomodulin
- parvin, gamma

Reviews

Buy IL26-interleukin 26 Gene now

Add to cart