Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of IL4-interleukin 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL4-interleukin 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC067514 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL4 |
| Origin species: | Human |
| Product name: | IL4-interleukin 4 Gene |
| Size: | 2ug |
| Accessions: | BC067514 |
| Gene id: | 3565 |
| Gene description: | interleukin 4 |
| Synonyms: | BCGF-1; BCGF1; BSF-1; BSF1; interleukin-4; B cell growth factor 1; B_cell stimulatory factor 1; binetrakin; interleukin 4 variant 2; lymphocyte stimulatory factor 1; pitrakinra; interleukin 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtctcacctcccaactgcttccccctctgttcttcctgctagcatgtgccggcaactttgtccacggacacaagtgcgatatcaccttacaggagatcatcaaaactttgaacagcctcacagagcagaagactctgtgcaccgagttgaccgtaacagacatctttgctgcctccaagaacacaactgagaaggaaaccttctgcagggctgcgactgtgctccggcagttctacagccaccatgagaaggacactcgctgcctgggtgcgactgcacagcagttccacaggcacaagcagctgatccgattcctgaaacggctcgacaggaacctctggggcctggcgggcttgaattcctgtcctgtgaaggaagccaaccagagtacgttggaaaacttcttggaaaggctaaagacgatcatgagagagaaatattcaaagtgttcgagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - interleukin 2 - KIAA1161 - neuregulin 1 - KIAA0467 |