Cart 2 Product Products 228,64 € (empty)
-
-
1 x IGF2-insul...113,40 €
No products
To be determined Shipping
228,64 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 228,64 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 228,64 €
Data sheet of ARHGAP5-Rho GTPase activating protein 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARHGAP5-Rho GTPase activating protein 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC075799 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARHGAP5 |
| Origin species: | Human |
| Product name: | ARHGAP5-Rho GTPase activating protein 5 Gene |
| Size: | 2ug |
| Accessions: | BC075799 |
| Gene id: | 394 |
| Gene description: | Rho GTPase activating protein 5 |
| Synonyms: | GFI2; RhoGAP5; p190-B; p190BRhoGAP; rho GTPase-activating protein 5; growth factor independent 2; p100 RasGAP-associated p105 protein; p105 RhoGAP; rho-type GTPase-activating protein 5; Rho GTPase activating protein 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgctgccgccgccaccgccggggccgctgccgttgaggaggagacggaggagaccgacgttgttagggttatgtaccgaaggactctaccgtgtcagcgggaataaaactgaccaagacaatattcaaaagcagtttgatcaagatcataatatcaatctagtgtcaatggaagtaacagtaaatgctgtagctggagcccttaaagctttctttgcagatctgccagatcctttaattccatattctcttcatccagaactattggaagcagcaaaaatcccggataaaacagaacgtcttcatgccttgaaagaaattgttaagaaatttcatcctgtaaactatgatgtattcagatacgtgataacacatctaaacagggttagtcagcaacataaaatcaacctaatgacagcagacaacttatccatctgtttttggccaaccttgatgagacctgattttgaaaatcgagagtttctgtctactactaagattcatcaatctgttgttgaaacattcattcagcagtgtcagtttttcttttacaatggagaaattgtagaaacgacaaacattgtggctcctccaccaccttcaaacccaggacagttggtggaaccaatggtgccacttcagttgccgccaccattgcaacctcagctgatacaaccacaattacaaacggatcctcttggtattatatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - interleukin 23, alpha subunit p19 - FERM and PDZ domain containing 2 - RAB1B, member RAS oncogene family - Ewing sarcoma breakpoint region 1 |