IL23A-interleukin 23, alpha subunit p19 Gene View larger

IL23A-interleukin 23, alpha subunit p19 Gene

PTXBC067511

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IL23A-interleukin 23, alpha subunit p19 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IL23A-interleukin 23, alpha subunit p19 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC067511
Product type: DNA & cDNA
Ncbi symbol: IL23A
Origin species: Human
Product name: IL23A-interleukin 23, alpha subunit p19 Gene
Size: 2ug
Accessions: BC067511
Gene id: 51561
Gene description: interleukin 23, alpha subunit p19
Synonyms: IL-23; IL-23A; IL23P19; P19; SGRF; interleukin-23 subunit alpha; IL-23 subunit alpha; IL-23-A; IL-23p19; JKA3 induced upon T-cell activation; interleukin 23 p19 subunit; interleukin 23, alpha subunit p19; interleukin-23 subunit p19; interleukin-six, G-CSF related factor; interleukin 23 subunit alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggggagcagagctgtaatgctgctgttgctgctgccctggacagctcagggcagagctgtgcctgggggcagcagccctgcctggactcagtgccagcagctttcacagaagctctgcacactggcctggagtgcacatccactagtgggacacatggatctaagagaagagggagatgaagagactacaaatgatgttccccatatccagtgtggagatggctgtgacccccaaggactcagggacaacagtcagttctgcttgcaaaggatccaccagggtctgattttttatgagaagctgctaggatcggatattttcacaggggagccttctctgctccctgatagccctgtgggccagcttcatgcctccctactgggcctcagccaactcctgcagcctgagggtcaccactgggagactcagcagattccaagcctcagtcccagccagccatggcagcgtctccttctccgcttcaaaatccttcgcagcctccaggcctttgtggctgtagccgcccgggtctttgcccatggagcagcaaccctgagtccctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Rho GTPase activating protein 5
- interleukin 23, alpha subunit p19
- FERM and PDZ domain containing 2
- RAB1B, member RAS oncogene family

Reviews

Buy IL23A-interleukin 23, alpha subunit p19 Gene now

Add to cart