Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HIST1H4I-histone cluster 1, H4i Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIST1H4I-histone cluster 1, H4i Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066250 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIST1H4I |
| Origin species: | Human |
| Product name: | HIST1H4I-histone cluster 1, H4i Gene |
| Size: | 2ug |
| Accessions: | BC066250 |
| Gene id: | 8294 |
| Gene description: | histone cluster 1, H4i |
| Synonyms: | H4/m; H4FM; H4M; histone H4; H4 histone family, member M; Histone 4 family, member M; histone 1, H4i; histone cluster 1, H4i; histone family member; histone cluster 1 H4 family member i |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctggccgcggcaaaggaggtaagggcctggggaaagggggtgccaagcgccaccgcaaggtgctgcgcgacaacatccagggtatcaccaagccagccattcggcgccttgctcgccgcggcggcgtgaagcgcatttctggcctcatctatgaggagacccgcggagtgttgaaggtgttcctggagaacgtgatccgggacgccgtgacctacacggagcacgccaagcgcaagacggtcaccgccatggacgtggtctacgcgctcaagcgccagggccgcaccctctatggcttcggcggctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ferritin, light polypeptide - high-mobility group box 3 - aquaporin 7 pseudogene 2 - stathmin 1/oncoprotein 18 |