Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of IL9-interleukin 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL9-interleukin 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066285 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL9 |
| Origin species: | Human |
| Product name: | IL9-interleukin 9 Gene |
| Size: | 2ug |
| Accessions: | BC066285 |
| Gene id: | 3578 |
| Gene description: | interleukin 9 |
| Synonyms: | HP40; IL-9; P40; interleukin-9; T-cell growth factor p40; cytokine P40; homolog of mouse T cell and mast cell growth factor 40; p40 T-cell and mast cell growth factor; p40 cytokine; interleukin 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcttctggccatggtccttacctctgccctgctcctgtgctccgtggcaggccaggggtgtccaaccttggcggggatcctggacatcaacttcctcatcaacaagatgcaggaagatccagcttccaagtgccactgcagtgctaatgtgaccagttgtctctgtttgggcattccctctgacaactgcaccagaccatgcttcagtgagagactgtctcagatgaccaataccaccatgcaaacaagatacccactgattttcagtcgggtgaaaaaatcagttgaagtactaaagaacaacaagtgtccatatttttcctgtgaacagccatgcaaccaaaccacggcaggcaacgcgctgacatttctgaagagtcttctggaaattttccagaaagaaaagatgagagggatgagaggcaagatatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - interleukin 4 - interleukin 2 - KIAA1161 - neuregulin 1 |